--------------------------------------------------------------------------- Emerging Infectious Diseases * Volume 3 * Number 2 * April-June 1997 --------------------------------------------------------------------------- Perspective * The Economic Impact of a Bioterrorist Attack: Are Prevention and Postattack Intervention Programs Justifiable? A.F. Kaufmann, M.I. Meltzer, G.P. Schmid Synopses * Hantaviruses: A Global Disease Problem C. Schmaljohn and B. Hjelle * Japanese Spotted Fever: Report of 31 Cases and Review of the Literature * F. Mahara This article is also available in Japanese at http://www.cdc.gov/ncidod/EID/eid.htm * Polycystic Kidney Disease: An Unrecognized Emerging Infectious Disease? M.A. Miller-Hjelle, J.T. Hjelle, M. Jones, W.R. Mayberry, M.A. Dombrink-Kurtzman, S.W. Peterson, D.M. Nowak, and F.S. Darras * Borna Disease C.G.Hatalski,A.J.Lewis,and W.I. Lipkin * The Rickettsia: an Emerging Group of Pathogens in Fish J.L. Fryer and M.J. Mauel * Rhodococcus equi and Arcanobacterium haemolyticum: Two "Coryneform"Bacteria Increasingly Recognized as Agents of Human Infection R. Linder * Is Creutzfeldt-Jakob Disease Transmitted in Blood? M.N. Ricketts, N.R. Cashman, E.E. Stratton, S. ElSaadany Dispatches * A New Tick-borne Encephalitis-like Virus Infecting New England Deer Ticks, Ixodes dammini S.R. Telford III, P.M. Armstrong, P. Katavolos, I. Foppa, A.S.O. Garcia, M.L. Wilson, A. Spielman * An Unusual Hantavirus Outbreak in Southern Argentina: Person-to-Person Transmission? R.M. Wells, S.S. Estani, Z.E. Yadon, D. Enria, P. Padula, N. Pini, J.N. Mills, C.J. Peters, E.L. Segura, and the Hantavirus Pulmonary Syndrome Study Group for Patagonia * Pertussis in the Netherlands: an Outbreak Despite High Levels of Immunization with Whole-Cell Vaccine H.E. de Melker, M.A.E. Conyn-van Spaendonck, H.C. Rümke, J.K. van Wijngaarden, F.R. Mooi, and J.F.P. Schellekens * Invasive Haemophilus influenzae type b Disease in Elderly Nursing Home Residents: Two Related Cases T.C. Heath, M.C. Hewitt, B. Jalaludin, C. Roberts, A.G. Capon, P. Jelfs, and G.L. Gilbert * Seroepidemiologic Studies of Hantavirus Infection Among Wild Rodents in California M. Jay, M.S. Ascher, B.B. Chomel, M. Madon, D. Sesline, B.A. Enge, B. Hjelle, T.G. Ksiazek, P. E. Rollin, P.H. Kass, and K. Reilly * Gestational Psittacosis in a Montana Sheep Rancher D.M. Jorgensen * Lack of Serologic Evidence for an Association between Cache Valley Virus Infection and Anencephaly and Other Neural Tube Defects in Texas J.F. Edwards and K. Hendricks * Rabies Postexposure Prophylaxis Survey Kentucky M. Auslander and C. Kaelin Commentary * Biologic Terrorism Responding to the Threat P.K. Russell From the 1st International Conference on Emerging Zoonoses The articles in this section were originally presented at the 1st International Conference on Emerging Zoonoses, Jerusalem, Israel, November 24-28, 1996. The conference was cosponsored by the Centers for Disease Control and Prevention and the Israel Center for Disease Control. * The Hantaviruses of Europe: from the Bedside to the Bench J. Clement, P. Heyman, P. McKenna, P. Colson, and T. Avsic-Zupanc * Brucellosis: an Overview M.J. Corbel * Global Aspects of Emerging and Potential Zoonoses: a WHO Perspective F.-X. Meslin * Epidemiology of Emerging Zoonoses in Israel A. Shimshony * Electronic Media and Emerging Zoonoses S.A. Berger Letters * The Reemergence of Aedes aegypti in Arizona D.M. Engelthaler, T.M. Fink, C.E. Levy and M.J. Leslie * Treatment of Exudative Pharyngitis P.D. Ellner * Reply to P.D. Ellner H.S. Izurieta, P.M. Strebel, T. Youngblood, D.G. Hollis, and T. Popovic News and Notes * Molecular Epidemiology and Evolutionary Genetics of Pathogenic Microorganisms * Simian Virus 40 (SV40) * Foodborne Pathogens: Implications and Control * Emerging Infectious Diseases in the Pacific Rim * Emerging Zoonotic Infectious Diseases * Hantavirus Conference * International Conference on Emerging Infectious Diseases * Emerging Infectious Diseases Laboratory Fellowship Program * Emerging Infections: Clinical and Pathologic Update II * Rabies Conference * Erratum --------------------------------------------------------------------------- About EID Emerging Infectious Diseases is indexed in Index Medicus/Medline, Current Contents, and several other electronic databases. Emerging Infectious Diseases is part of CDC's plan for combatting emerging infectious diseases; the plan is outlined in a recently published document, Addressing Emerging Infectious Disease Threats--A Prevention Strategy for the United States. One of the main goals of CDC's plan is to enhance communication of public health information about emerging diseases so that prevention measures can be implemented without delay. Emerging Infectious Diseases is peer reviewed and will be providing information on emerging infections in three broad categories: 1) Perspectives, a section addressing factors that underlie disease emergence including microbial adaptation and change, human demographics and behavior, technology and industry, economic development and land use, international travel and commerce, and breakdown of public health measures; 2) Synopses, concise, state-of-the-art summaries of specific diseases or syndromes and related emerging infectious disease issues; 3) Dispatches, brief laboratory or epidemiologic reports with an international scope. --------------------------------------------------------------------------- Editors Editor Joseph E. McDade, Ph.D., National Center for Infectious Diseases Centers for Disease Control and Prevention (CDC), Atlanta, Georgia, USA Perspectives Editor Stephen S. Morse, Ph.D.,The Rockefeller University, New York, New York, USA Synopses Editor Phillip J. Baker, Ph.D., Division of Microbiology and Infectious Diseases, National Institute of Allergy and Infectious Diseases, National Institutes of Health, Bethesda, Maryland, USA Dispatches Editor Stephen Ostroff, M.D., National Center for Infectious Diseases, CDC, Atlanta, Georgia, USA Managing Editor Polyxeni Potter, M.A., National Center for Infectious Diseases, Centers for Disease Control and Prevention (CDC), Atlanta, Georgia, USA --------------------------------------------------------------------------- Liaison Representatives Anthony I. Adams, M.D., Chief Medical Adviser, Commonwealth Department of Human Services and Health, Canberra, Australia David Brandling-Bennett, M.D., Deputy Director, Division of Communicable Diseases, Pan American Health Organization, World Health Organization Washington, D.C., USA Gail Cassell, Ph.D., Liaison to American Society for Microbiology University of Alabama at Birmingham Birmingham, Alabama, USA Richard A. Goodman, M.D., M.P.H., Editor, MMWR, CDC, Atlanta, Georgia, USA Thomas M. Gomez. D.V.M.,M.S., Staff Epidemiologist U.S. Department of Agriculture Animal and Plant Health Inspection Service Riverdale, Maryland, USA Joseph Losos, M.D., Director General, Laboratory Center for Disease Control Ontario, Canada Gerald L. Mandell, M.D., Liaison to Infectious Diseases Society of America, University of Virginia Medical Center, Charlottesville, Virginia, USA William J. Martone, M.D., Senior Executive Director National Foundation for Infectious Diseases Bethesda, Maryland, USA Phillip P. Mortimer, M.D., Director, Virus Reference Division Central Public Health Laboratory London, United Kingdom Robert Shope, M.D., Director, Yale Arbovirus Research Unit, Yale University School of Medicine, New Haven, Connecticut, USA Natalya B. Sipachova, M.D., Ph.D. Scientific Editor Russian Republic Information & Analytic Centre Moscow, Russia Bonnie Smoak, M.D. U.S. Army Medical Research Unit—Kenya Unit 64109 Box 401 APO AE 09831-4109 Robert Swanepoel, B.V.Sc., Ph.D., Head, Special Pathogens Unit, National Institute for Virology, Sandrinham 2131, South Africa Roberto Tapia-Conyer, M.D. Dirección General de Epidemiología Secretaría de Salud México --------------------------------------------------------------------------- Editorial and Computer Support Editing and Production Beatrice T. Divine, M.B.A. Teresa M. Hood, M.S. Editorial Assistance Maria T. Brito Electronic Distribution Carol Y. Crawford David L. Smith Cover Design Mindy Barringer Martha F. Boyd --------------------------------------------------------------------------- Electronic Journal Citation Style Suggested citation for advance dispatches and for journal articles in ascii or html files: Example Fischer JR, Stallknecht DE, Luttrell MP, Dhondt AA, Converse KA. Mycoplasmal conjunctivitis in wild songbirds: The spread of a new contagious disease in a mobile host population. Emerg Infect Dis [serial online] 1997; 3(1): 14 pars. Available: http://www.cdc.gov/ncidod/EID/vol3no1/edwards.htm. Date posted: 1997 Jan 10. --------------------------------------------------------------------------- Emerging Infectious Diseases Emerging Infectious Diseases is published four times a year by the National Center for Infectious Diseases, Centers for Disease Control and Prevention (CDC), 1600 Clifton Road, Mailstop C-12, Atlanta, GA 30333, USA. Telephone 404-639-3967, fax 404-639-3039, e-mail eideditor@cdc.gov. The opinions expressed by authors contributing to this journal do not necessarily reflect the opinions of CDC or the institutions with which the authors are affiliated. All material published in Emerging Infectious Diseases is in the public domain and may be used and reprinted without special permission; proper citation, however, is appreciated. Use of trade names is for identification only and does not imply endorsement by the Public Health Service or by the U.S. Department of Health and Human Services. Emerging Infectious Diseases is printed on acid free paper that meets the requirements of ANSI/NISO 239.48-1992 (Permanence of Paper). --------------------------------------------------------------------------- Electronic access to EID EID is also available on the Internet through File Transfer Protocol (FTP) and electronic mail. --------------------------------------------------------------------------- FTP Download the journal through anonymous FTP to ftp.cdc.gov. The files can be found in the pub/EID directory in each of the file types listed below. A Spanish version of the journal's first volume is available electronically from the Universidad de la Plata, Argentina (ftp://fcv.medvet.unlp.edu.ar). LISTSERVer (E-Mail Lists) Because of the large file sizes of the journal and the complexity of sending the journal to different e-mail systems, it is strongly recommended that if you have FTP capabilities, you choose to access EID through FTP rather than e-mail lists. However, if you do not have FTP, you may have the journal sent to your electronic mailbox by subscribing to one of four mailing lists. Choose the list with the file type that best meets your computing environment. There are four lists available: * EID-TOC sends the table of contents and allows you to request individual articles. (This file is typically 10-15 kb.) * EID-ASCII sends the journal in ASCII format. (This file is typically 200-400 kb.) * EID-PDF sends the journal in Adobe Acrobat format. You can get the Adobe Acrobat Reader free by subscribing to this list. (This file is typically 500-900 kb.) * EID-PS sends the journal in PostScript format. (This file is typically 4-8 Mb.) To subscribe to a list, use the Subscription Form or send an e-mail to listserv@cdc.gov with the following in the body of your message: subscribe listname (e.g., subscribe EID-PS) Once you have requested a subscription, you will receive a confirmation and further instructions by e-mail. File formats available The journal is available in three file formats: ASCII, Adobe Acrobat (.pdf), and PostScript (.ps). The ASCII version of the journal does not contain figures. Both the .pdf and .ps files, however, contain graphics and figures and are true representations of the hard copy of the journal. The Adobe Acrobat format requires an Adobe Reader (available at no charge from CDC through FTP, LISTSERVer, or World-Wide Web [WWW]. This reader is available in DOS, Windows, UNIX, and Macintosh versions and will allow you to view and print the journal just as it looks in hard copy. Installation instructions come with the Adobe software. Electronic Journal Citation Style Suggested citation for advance dispatches and for journal articles in ascii or html files: Example Fischer JR, Stallknecht DE, Luttrell MP, Dhondt AA, Converse KA. Mycoplasmal conjunctivitis in wild songbirds: The spread of a new contagious disease in a mobile host population. Emerg Infect Dis [serial online] 1997; 3(1): 14 pars. Available: http://www.cdc.gov/ncidod/EID/vol3no1/ edwards.htm. Date posted: 1997 Jan 10. --------------------------------------------------------------------------- For more information about receiving EID electronically, send an e-mail to eidhelp@cdc.gov. --------------------------------------------------------------------------- Instructions to Authors Editorial Policy and Call for Articles Emerging Infectious Diseases (EID) is a peer-reviewed journal established expressly to promote the recognition of new and reemerging infectious diseases and to improve the understanding of factors involved in disease emergence, prevention, and elimination. EID has an international scope and is intended for professionals in infectious diseases and related sciences. We welcome contributions from infectious disease specialists in academia, industry, clinical practice, and public health as well as from specialists in economics, demography, sociology, and other disciplines. Inquiries about the suitability of proposed articles may be directed to the editor at 404-639-3967 (telephone), 404-639-3075 (fax), or eideditor@cdc.gov (e-mail). EID is published in English and features three types of articles: Perspectives, Synopses, and Dispatches. The purpose and requirements of each type of article are described in detail below. A Spanish version of the journal's first two volumes is available electronically from the Universidad de la Plata, Argentina (ftp://fcv.medvet.unlp.edu.ar). Articles by authors from non-English-speaking countries can be made simultaneously available in English and in the author's native language (electronic version of the journal only). Articles published in this way are translated from English into the author's native language and appear in the same issue of the journal. --------------------------------------------------------------------------- Instructions to Authors Manuscripts should be prepared according to the "Uniform Requirements for Manuscripts Submitted to Biomedical Journals" (Ann Intern Med 1997:126-36-47). Begin each of the following sections on a new page and in this order: title page, abstract, text, acknowledgments, references, each table, figure legends, and figures. On the title page, give complete information about each author (full names and highest degree). Give current mailing address for correspondence (include fax number and e-mail address). Follow Uniform Requirements style for references. Consult List of Journals Indexed in Index Medicus for accepted journal abbreviations. Tables and figures should be numbered separately (each beginning with 1) in the order of mention in the text. Double-space everything, including the title page, abstract, references, tables, and figure legends. Italicize scientific names of organisms from species name all the way up, except for vernacular names (viruses that have not really been speciated, such as coxsackievirus and hepatitis B; bacterial organisms, such as pseudomonads, salmonellae, and brucellae). All articles will be reviewed by independent reviewers. The Editor reserves the right to edit articles for clarity and to modify the format to fit the publication style of Emerging Infectious Diseases. Documents sent in hardcopy should also be sent on diskette, or by e-mail. Acceptable electronic formats for text are ASCII, WordPerfect, AmiPro, DisplayWrite, MS Word, MultiMate, Office Writer, WordStar, or Xywrite. Send graphics documents in Corel Draw, Harvard Graphics, Freelance, .TIF (TIFF), .GIF (CompuServe), .WMF (Windows Metafile), .EPS (Encapsulated Postscript), or .CGM (Computer Graphics Metafile). The preferred font for graphics files is Helvetica. If possible, convert Macintosh files into one of the suggested formats. Submit photographs in glossy, camera-ready photographic prints. Send all manuscripts and correspondence to the Editor, Emerging Infectious Diseases, National Center for Infectious Diseases, Centers for Disease Control and Prevention, 1600 Clifton Road, Mailstop C-12, Atlanta, GA 30333, USA, or by e-mail to eideditor@cdc.gov. Perspectives: Contributions to the Perspectives section should provide insightful analysis and commentary about new and reemerging infectious diseases or related issues. Perspectives may also address factors known to influence the emergence of infectious diseases, including microbial adaption and change; human demographics and behavior; technology and industry; economic development and land use; international travel and commerce; and the breakdown of public health measures. Articles should be approximately 3,500 words and should include references, not to exceed 40. Use of additional subheadings in the main body of the text is recommended. If detailed methods are included, a separate section on experimental procedures should immediately follow the body of the text. Photographs and illustrations are optional. Provide a short abstract (150 words) and a brief biographical sketch. Synopses: Submit concise reviews of infectious diseases or closely related topics. Preference will be given to reviews of new and emerging diseases; however, timely updates of other diseases or topics are also welcome. Synopses should be approximately 3,500 words and should include references, not to exceed 40. Use of subheadings in the main body of the text is recommended. If detailed methods are included, a separate section on experimental procedures should immediately follow the body of the text. Photographs and illustrations are encouraged. Provide a short abstract (150 words) and a brief biographical sketch. Dispatches: Provide brief updates on trends in infectious diseases or infectious disease research. Dispatches (1,000 to 1,500 words of text) should be in a letter to the editor format and should not be divided into sections. Dispatches should begin with a brief introductory statement about the relationship of the topic to the emergence of infectious diseases. Provide references, not to exceed 10, and figures or illustrations, not to exceed two. To expedite publication of information of a more urgent nature, we post the journal's dispatches on the Internet as soon as they are cleared and edited. As soon as the full issue is completed, these dispatches become part of the issue. --------------------------------------------------------------------------- [Emerging Infectious Diseases * Volume 3 * Number 2 * April-June 1997] Perspective The Economic Impact of a Bioterrorist Attack: Are Prevention and Postattack Intervention Programs Justifiable? Arnold F. Kaufmann, Martin I. Meltzer, and George P. Schmid Centers for Disease Control and Prevention, Atlanta, Georgia, USA --------------------------------------------------------------------------- Understanding and quantifying the impact of a bioterrorist attack are essential in developing public health preparedness for such an attack. We constructed a model that compares the impact of three classic agents of biologic warfare (Bacillus anthracis, Brucella melitensis, and Francisella tularensis) when released as aerosols in the suburb of a major city. The model shows that the economic impact of a bioterrorist attack can range from an estimated $477.7 million per 100,000 persons exposed (brucellosis scenario) to $26.2 billion per 100,000 persons exposed (anthrax scenario). Rapid implementation of a postattack prophylaxis program is the single most important means of reducing these losses. By using an insurance analogy, our model provides economic justification for preparedness measures. Bioterrorism and its potential for mass destruction have been subjects of increasing international concern. Approximately 17 countries (including five implicated as sponsors of international terrorism) may have active research and development programs for biologic weapons (1). Moreover, groups and individuals with grievances against the government or society have been known to use or plan to use biologic weapons to further personal causes. Only modest microbiologic skills are needed to produce and effectively use biologic weapons. The greatest, but not insurmountable, hurdle in such an endeavor may be gaining access to a virulent strain of the desired agent. Production costs are low, and aerosol dispersal equipment from commercial sources can be adapted for biologic weapon dissemination. Bioterrorists operating in a civilian environment have relative freedom of movement, which could allow them to use freshly grown microbial suspensions (storage reduces viability and virulence). Moreover, bioterrorists may not be constrained by the need for precise targeting or predictable results. The impact of a bioterrorist attack depends on the specific agent or toxin used, the method and efficiency of dispersal, the population exposed, the level of immunity in the population, the availability of effective postexposure and/or therapeutic regimens, and the potential for secondary transmission. Understanding and quantifying the impact of a bioterrorist attack are essential to developing an effective response. Therefore, we have analyzed the comparative impact of three classic biologic warfare agents (Bacillus anthracis, Brucella melitensis, and Francisella tularensis) when released as aerosols in the suburbs of a major city and compared the benefits of systematic intervention with the costs of increased disease incidence (from the economic point of view used in society). Analytic Approach Scenario Assumptions We compared the impact of a theoretical bioterrorist attack on a suburb of a major city, with 100,000 population exposed in the target area. The attack was made by generating an aerosol of an agent (B. anthracis spores, B. melitensis, or F. tularensis) along a line across the direction of the prevailing wind. The meteorologic conditions (thermal stability, relative humidity, wind direction and speed) were assumed to be optimal (2), and the aerosol cloud passed over the target area within 2 hours. We projected impact on the basis of 10% and 100% of the target population being exposed to the aerosol cloud. We assumed that, when inhaled, the infectious dose50 (ID50) was 20,000 spores for B. anthracis and 1,000 vegetative cells for B. melitensis and F. tularensis. The rate of physical decay for airborne particles 5 mm or less in diameter was estimated to be negligible during the 2-hour transit time. The rate of biologic decay of the particulate agents was estimated to be negligible for the B. anthracis spores and 2% per minute for the B. melitensis and F. tularensis vegetative cells. Viability and virulence did not dissociate. Persons who were exposed to the B. anthracis cloud at any point during the 2-hour transit time inhaled one ID50 dose, and persons who were exposed to either the B. melitensis or F. tularensis cloud inhaled one to 10 ID50 doses, depending on their proximity to the origination point of the aerosol cloud. The epidemic curve for anthrax by days after exposure was assumed to be <1 day, 0% of cases; 1 day, 5%; 2 days, 20%; 3 days, 35%; 4 days, 20%; 5 days, 10%; 6 days, 5%; and 7 or more days, 5% (3-5). Case-fatality rates were also assumed to vary by the day symptoms were first noted. The case-fatality rate was estimated as 85% for patients with symptoms on day 1; 80% for patients with symptoms on day 2; 70% for those with symptoms on day 3; 50% for those with symptoms on days 4, 5, and 6; and 70% for those with symptoms on and after day 7. The increased death rate in persons with an incubation period of 7 or more days is calculated on an assumption of delayed diagnosis, with resultant delayed therapy. When estimating days in hospital and outpatient visits due to infection, we assumed that 95% of anthrax patients were hospitalized, with a mean stay of 7 days. Patients not admitted to a hospital had an average of seven outpatient visits, and surviving hospitalized patients had two outpatient visits after discharge from the hospital. Persons who received only outpatient care were treated for 28 days with either oral ciprofloxacin or doxycycline. No significant long-term sequelae resulted from the primary infection, and no relapses occurred. The epidemic curve for brucellosis by days after exposure was assumed to be 0 to 7 days, 4% of cases; 8 to 14 days, 6%; 15 to 28 days, 14%; 29 to 56 days, 40%; 57 to 112 days, 26%, and 113 or more days, 10% (4, 6-9). The case-fatality rate was estimated to be 0.5%. Fifty percent of patients were hospitalized, with an average stay of 7 days. Nonhospitalized patients had an average of 14 outpatient visits, and hospitalized patients had seven outpatient visits after discharge from the hospital. Outpatients received a combination of oral doxycycline for 42 days and parenteral gentamicin for the first 7 days of therapy. Five percent of patients had a relapse or long-term sequelae, and required 14 outpatient visits within 1 year. The epidemic curve for tularemia by days after exposure was assumed to be: <1 day, 0% of cases; 1 day, 1%; 2 days, 15%; 3 days, 45%; 4 days, 25%; 5 days, 10%; 6 days, 3%; and 7 or more days, 1% (4,10-11). The estimated case-fatality rate was 7.5%; and 95% of patients were hospitalized, with an average stay of 10 days. Nonhospitalized patients had an average of 12 outpatient visits, and hospitalized patients who survived the acute illness had two outpatient visits after discharge from the hospital. Outpatients received oral doxycycline for 14 days and parenteral gentamicin for 7 days. Five percent of patients had a relapse or long-term sequelae and required an average of 12 outpatient visits. The efficacy of intervention strategies is unknown; our projections are our best estimates based on published clinical and experimental data (4,12-14). For anthrax, the projected intervention program was either a 28-day course of oral ciprofloxacin or doxycycline (assumed to be 90% effective), or a 28-day course of oral ciprofloxacin or doxycycline plus three doses of the human anthrax vaccine (assumed to be 95% effective); for brucellosis, a 42-day course of oral doxycycline and rifampin (assumed to be 80% effective), or a 42-day course of oral doxycycline, plus 7 days of parenteral gentamicin (assumed to be 95% effective); for tularemia, the intervention program was a 14-day course of oral doxycycline (assumed to be 80% effective), or a 14-day course of oral doxycycline plus 7 days of parenteral gentamicin (assumed to be 95% effective). Only 90% of persons exposed in the target area were assumed to effectively participate in any intervention program. Because the target area cannot be precisely defined, we estimated that for every exposed person participating in the intervention program, an additional 5, 10, or 15 nonexposed persons would also participate. Economic Analyses of Postattack Intervention To analyze the economic factors involved in establishing an intervention program, we compared the costs to the potential savings from such an intervention. Following the recommendation of the Panel of Cost-Effectiveness in Health and Medicine (PCEHM), we used estimates of actual costs rather than financial charges or market prices, which usually incorporate profit (15). We calculated the net savings (cost reductions) by using the following formula: Net savings = (number of deaths averted x present value of expected future earnings) + (number of days of hospitalization averted x cost of hospitalization) + (number of outpatient visits averted x cost of outpatient visits) - cost of intervention. When we calculated the costs of hospitalization and outpatient visits, we assumed that only persons with symptoms (i.e., case-patients) would use medical facilities. The remainder of the exposed and potentially exposed populace would receive postexposure prophylaxis. Present Value of Expected Future Earnings The cost of a premature human death was nominally valued at the present value of expected future earnings and housekeeping services, weighted by the age and sex composition of the work force in the United States (16). The undiscounted average of future earnings is $1,688,595. As recommended by PCEHM (17), the stream of future earnings was discounted at 3% and 5%, to give values of $790,440 and $544,160, respectively. The present value of expected future earnings was estimated with 1990 dollars, adjusted for a 1% annual growth in productivity (16). However, in constant terms (1982 dollars), the average hourly earnings in private industry fell from $7.52 in 1990 to $7.40 in 1994 (18); therefore, the estimate of future earnings was not adjusted upwards. Cost of Hospitalization In 1993, the average charge for a single day of hospitalization was $875 (19). To derive true cost, we multiplied the average charge by the cost-to-charge ratio of 0.635, (the April 1994 statewide average cost-to-charge ratio for urban hospitals in New York state) (16). On this basis, we estimated true hospitalization costs at $556/day (Table 1). Hospital costs included all professional services, drugs, x-rays, and laboratory tests. Lost productivity during hospital stay was valued at $65/day (the value of an "unspecified" day's earnings, weighted for age and sex composition of the U.S. work force) (16). Table 1. Costs of hospitalization and outpatient visits (OPVs) following a bioterrorist attack --------------------------------------------------------------------------- Anthrax Tularemia Brucellosis Base Upper Base Upper Base Upper --------------------------------------------------------------------------- Hospitalized patient Days in hospital 7 7 10 10 7 7 Cost per day ($)(a) 556 669 556 669 556 669 Lost productivity ($/day) 65 65 65 65 65 65 Follow-up OPVs (no.) 2 2 2 2 7 7 Cost 1st OPV ($) 28 44 28 44 28 44 Cost other OPVs, ea. ($) 13 24 13 24 13 24 OPV laboratory ($)(b,c) 87 174 87 174 131 261 OPV x-rays costs ($)(d) 66 66 0 0 0 0 Lost productivity ($/OPV)(e) 16 16 16 16 16 16 Total costs ($) 4,541 5,380 6,338 7,582 4,584 5,587 Avg. costs/day ($/day) 649 769 634 758 655 798 % increase: Base to upper estimate 18 20 22 Nonhospitalized patient Number of OPVs 7 7 12 12 14 14 Cost 1st OPV ($) 28 44 28 44 28 44 Cost other OPVs, ea. ($) 13 24 13 24 13 24 Lost productivity ($/OPV)(e) 16 16 16 16 16 16 Laboratory costs ($)(b,f) 131 174 261 522 261 522 X-ray costs ($)(d) 66 66 66 66 66 66 Drugs used(g) D C D+G D+G D+R D+R+G Cost of drugs ($) 6 181 29 29 220 246 Total costs ($) 422 810 722 1,120 972 1,418 Avg. costs/day ($/day) 60 116 60 93 69 101 % increase: Base to upper estimate 93 55 46 --------------------------------------------------------------------------- Notes: All costs rounded to the nearest whole dollar. (a)Hospital costs assumed to include all costs such as drugs, laboratory tests, and x-rays. (b)Laboratory tests consists of general health panel (CPT code 80050) and an antigen or antibody test (modeled on the cost of a Streptococcus screen, CPT code 86588). (c)Follow-up OPVs for hospitalized patients included two laboratory test sets for anthrax and tularemia patients and three laboratory test sets for brucellosis patients. (d)X-ray costs (CPT code 71021), included two sets taken at different OPVs. (e)Productivity lost due to an OPV was assumed to be one-quarter of an unspecified day's value. (f)For OPVs of nonhospitalized patients, one set of laboratory tests is assumed for every two visits. (g)Drugs used: D = doxycycline; C = ciprofloxacin; R = rifampin. Sources: See text for explanation of sources of cost estimates. Cost of Posthospitalization Outpatient Visits After discharge from the hospital, a patient was assumed to have follow-up outpatient visits, the number of which varied by disease (Table 1). Outpatient visit costs were valued by using the Medicare National Average Allowance (20), which was chosen to represent the equivalent of bulk purchase discounted costs (i.e., actual costs) (Table 1). The first visit has a Current Procedural Terminology (CPT) code of 99201, which is classified as a "level 1" visit, requiring a physician to spend an average of 10 minutes with a patient (20). Subsequent level 1 visits, with the physician spending an average of 5 minutes with each patient, have a CPT code of 99211 (20). During outpatient visits, a general health panel test incorporating clinical chemistry tests and complete blood counts (CPT code 80050) and a single antigen or antibody detection test (e.g., CPT code 86558) were assumed to be ordered (20). Although data on Medicare allowances for office visits and many other procedures were available, data on Medicare allowances for laboratory tests were not. Thus, to establish the costs of the tests, we arbitrarily divided the lowest allowable charge for each test in half. X-rays (CPT code 71021) were valued according to the Medicare National Average Allowance (Table 1). In terms of lost productivity, we assumed that each outpatient visit cost the equivalent of 2 hours, or one-quarter, of the value of an unspecified day (16). Cost of Outpatient Visits of Nonhospitalized Patients For nonhospitalized outpatients, the cost of each visit, laboratory test, x-ray, and lost productivity was the same as an outpatient visit for discharged hospital patients and varied by disease (Table 1). We assumed that one set of laboratory tests would be ordered every other visit and that two sets of x-rays (CPT code 71021) would be ordered during the therapeutic course. Drug costs are discussed below. Cost of an Intervention The costs of an intervention can be expressed as follows: Cost of intervention = (cost of drugs used) x ([number of people exposed x multiplication factor] - number killed - number hospitalized - number of persons who require outpatient visits). The intervention costs per person depend directly on the costs of the antimicrobial agents and vaccines used in a prophylaxis program (Table 2). We obtained drug prices from the 1996 Drug Topics Red Book and used the lowest cost available for each drug (21). The cost of doxycycline ($0.22 per 200 mg total daily dose) was the Health Care Financing Administration cost, whereas the cost of gentamicin ($3.76 per 160 mg total daily dose), ciprofloxacin ($3.70 per 1,000 mg total daily dose), and rifampin ($5.01 per 900 mg total daily dose) were wholesale costs from pharmaceutical companies. The cost of anthrax vaccine was $3.70 per dose (Helen Miller-Scott, pers. comm., 1996). The cost of administering one vaccine dose or gentamicin injection was estimated at $10.00, on the basis of the 1992 cost of administering a vaccine in a clinical setting (Valerie Kokor, pers. comm., 1996). In estimating the cost of administering oral antimicrobial agents, we assumed weekly visits, during which the drug would be distributed and counseling would be given ($15.00 for the first visit and $10.00 for each subsequent visit). Table 2. Costs of prophylaxis following a bioterrorist attack --------------------------------------------------------------------------- Level of effectiveness Anthrax Tularemia Brucellosis --------------------------------------------------------------------------- Lower Effectiveness (%) 90 80 80 Drugs used(a) D or C D D+R Cost of drugs ($)(b) 6 or 181 3 220 No. of visits(c) 4 2 6 Total cost/ person ($) 51 or 226 28 285 Upper Effectiveness (%) 95 95 95 Drugs used(a) D+V or D+G D+G C+V Cost of drugs ($)(b ) 17 or 193 29 36 No. of visits(c) 4 7 12 Total cost/ person ($) 62 or 238 104 161 Minimum No. participants(d) 451,912 418,094 423,440 Maximum No. participants(e) 1,492,750 1,488,037 1,488,037 --------------------------------------------------------------------------- Notes: All costs are rounded to the nearest whole dollar. (a)Drugs used: D = doxycycline; C = ciprofloxacin; V = anthrax vaccine; G = gentamicin; R = rifampin. (b)See text for explanation of drug costs. (c)Cost of visit to drug-dispensing site: 1st visit = $15/person; follow-up visits = $10/person/visit. (d)Estimate assumed that the prophylaxis program was initiated on postattack day 6 for anthrax and tularemia and postattack day 113 for brucellosis, that the prophylaxis program had the lower effectiveness level, and that the multiplication factor for unnecessary prophylaxis given to unexposed persons was 5. (e)Estimate assumed that prophylaxis was initiated on postattack day 0 (day of release), that prophylaxis had the upper effectiveness level, and that the multiplication factor for unnecessary prophylaxis given to unexposed persons was 15. We assumed that more people would receive prophylaxis than were actually exposed because of general anxiety and uncertainty about the boundaries of the attack, the timing of the attack, and the time it would take nonresidents to travel through the attack area. Three different multiplication factors (5, 10, and 15) were used to construct within the population. Finally, ongoing intelligence gathering would detect possible bioterrorist threats. The cost of these prerequisite activities can be calculated if they are seen as a form of insurance, the goal of which is to "purchase" the maximum net savings through preparedness to manage the consequences of an attack and reduce the probability of an attack. The "actuarially fair premium" for the "insurance" can be defined as follows (22): Actuarially fair premium = reduction of loss probability x value of avoidable loss. The term "reduction of loss probability" indicates that, although increased surveillance and related activities can reduce the odds of an attack, they cannot guarantee absolute protection. The term "avoidable loss" refers to the fact that, even if a postexposure prophylaxis program were implemented on the day of release (day zero), some deaths, hospitalizations, and outpatient visits would be unavoidable. Various reductions of attack probability illustrated the impact of these estimates on the calculation of actuarially fair premiums. Such reductions included reducing the probability from 1 in 100 years (0.01) to 1 in 1,000 years (0.001), a reduction of 0.009, and reducing a probability from 1 in a 100 years (0.01) to 1 in 10,000 years (0.0001), and from 1 in 100 years (0.01) to 1 in 100,000 years (0.00001). The attack probability of 0.01 in the absence of enhanced preventive actions was selected for illustrative purposes and does not represent an official estimate. A range of minimum and maximum values of avoidable loss was derived from the net savings calculations. The values reflect differences in effectiveness of the various prophylaxis regimens, the reduced impact of delayed prophylaxis on illness and death, and the two discount rates used to calculate the present value of earnings lost because of death. Sensitivity Analyses In addition to the scenarios discussed above, three sensitivity analyses were conducted. First, the impact of increasing the cost of hospitalization and outpatient visits was assessed by using a set of upper estimates (Table 1). The cost of a hospital day was increased to $669 by increasing the cost-to-charge ratio from 0.634 to 0.764 (the ratio for Maryland) (16). The costs of outpatient visits (first and follow-up) were increased by assuming each visit was a "level 2" visit, doubling the average time a physician spends with each patient. The alternative cost-of-intervention scenarios that take into account persons who were not at risk but participated in the prophylaxis program. Thus, if 100,000 people were exposed, we assumed that the maximum number seeking prophylaxis was 500,000, 1,000,000, or 1,500,000. Economic Analysis of Preparedness: Insurance The analyses outlined above consider only the economics of an intervention after an attack and include several assumptions: First, stockpiles of drugs, vaccines, and other medical supplies would be available and could be rapidly moved to points of need. Second, civil, military, and other organizations would be in place and have the capability to rapidly identify the agent, dispense drugs, treat patients, and keep order costs of laboratory tests were increased to the full amount of the allowable charge (20). The second sensitivity analysis considered a reduced impact, in which only 10% of the original 100,000 target population were considered exposed. All other estimates were held constant. The third sensitivity analysis considered the threshold cost of an intervention, given differences due to the effectiveness of various drug regimens, and discount rates used to calculate the present value of expected lifetime earnings lost to a death. The threshold cost occurs when net savings equal $0. Thus, the threshold value represents the maximum that could be spent per person on an intervention without having the intervention cost more than the loss from no intervention. Findings Postattack Illness and Death In our model, all three biologic agents would cause high rates of illness and death. In the absence of an intervention program for the 100,000 persons exposed, the B. anthracis cloud would result in 50,000 cases of inhalation anthrax, with 32,875 deaths; the F. tularensis cloud in 82,500 cases of pneumonic or typhoidal tularemia, with 6,188 deaths; and the B. melitensis cloud in 82,500 cases of brucellosis requiring extended therapy, with 413 deaths. The speed with which a postattack intervention program can be effectively implemented is critical to its success (Figure 1). For diseases with short incubation periods such as anthrax and tularemia, a prophylaxis program must be instituted within 72 hours of exposure to prevent the maximum number of deaths, hospital days, and outpatient visits (Figure 1). Some benefit, however, can be obtained even if prophylaxis is begun as late as day 6 after exposure. The relative clinical efficacy of the intervention regimen has a lesser but definite impact on observed illness and death rates (Figure 1). [Figure 1] [Figures not available in ASCII version] Figure 1. Total deaths, hospital days, and outpatient visits associated with aerosol releases of B. anthracis, B. melitensis, and F. tularensis by the postattack day of prophylaxis initiation and level of prophylaxis effectiveness. A disease with a long incubation period such as brucellosis has a similar pattern (Figure 1); an important difference is the time available to implement an intervention program. Having more time available to implement an intervention program can make a marked difference in its effectiveness. However, the prolonged incubation period creates a greater potential for panic in potentially exposed persons because of the uncertainty about their health status. Economic Analyses of Postattack Intervention: No Program Without a postexposure prophylaxis program, an attack with B. anthracis is far costlier than attacks with F. tularensis or B. melitensis (Table 3). The differences between agents in medical costs as a percentage of total estimated costs are due to the large differences in death rates attributed to each agent (Figure 1). Table 3. Costs(a)($ millions) of a bioterrorist attack with no postexposure prophylaxis program --------------------------------------------------------------------------- Anthrax Tularemia Brucellosis --------------------------------------------------------------------------- Direct costs Medical: Base estimates(b) Hospital 194.1 445.8 170.3 OPV(c) 2.0 10.5 48.9 Medical: Upper estimates(d) Hospital 237.1 543.3 211.7 OPV(c) 4.4 18.5 78.3 Lost productivity Illness(e) Hospital 21.6 50.9 18.8 OPV(c) 0.7 3.9 15.0 Death 3% discount(f) 25,985.7 4,891.2 326.5 5% discount(f) 17,889.3 3,367.3 224.7 Total costs Base estimates 3% discount(f) 26,204.1 5,402.4 579.4 5% discount(f) 18,107.7 3,878.4 477.7 Upper estimates 3% discount(f) 26,249.7 5,507.9 650.1 5% discount(f) 18,153.1 3,983.9 548.4 --------------------------------------------------------------------------- (a)Assuming 100,000 exposed. (b)Medical costs are the costs of hospitalization (which include follow-up outpatient visits) and outpatient visits (Table 1). (c)OPV = outpatient visits. (d)Upper estimates calculated with data in Table 1. (e)Lost productivity due to illness is the value of time spent in hospital and during OPVs (Table 1). (f)Discount rate applied to calculate the present value of expected future earnings and housekeeping services, weighted by age and sex composition of the United States workforce (16), lost due to premature death. Net Savings Due to a Postexposure Prophylaxis Program If the postexposure prophylaxis program is initiated early, it reduces the economic impact of all three diseases, especially anthrax (Figure 2). Regardless of drug costs, the largest cost reductions are obtained through a combination of the most effective prophylaxis regimen (i.e., 95% effective, Table 2), the smallest multiplication factor to adjust for persons who unnecessarily receive prophylaxis, and a 3% discount rate to calculate the present value of the expected value of lifetime earnings. In the case of anthrax, either doxycycline or ciprofloxacin could be used in the intervention program (Table 2), but the use of doxycycline generated the largest savings. The largest difference in net savings between the two drugs was approximately $261.6 million. This difference occurred when it was assumed that the program began on day zero (day of release), each drug was used in combination with the anthrax vaccine, a 3% discount rate was used, and a multiplication factor of 15 for unnecessary prophylaxis was used. This amount is equal to approximately 1.2% of the maximum total net savings generated by using a regimen of doxycycline plus the anthrax vaccine. Some scenarios, particularly those in which prophylaxis programs were started late, generated negative net savings (i.e., net losses). In the case of tularemia, at a 5% discount rate, net losses of $10.7 to $115.1 million occurred when a post-exposure program was delayed until day 6 after exposure, and a prophylaxis regimen of doxycycline and gentamicin (estimated 95% efficacy) was used. For the same scenario, but with a 3% discount, a net savings of $1,513.3 million was observed when a multiplication factor of five for unnecessary prophylaxis was used. However, multiplication factors of 10 and 15 generated net losses of $49.8 and $102.0 million, respectively. With the same drug combination, beginning the program 1 day earlier (day 5 after exposure) resulted in net savings in all scenarios except when a multiplication factor of 15 and a discount rate of 5% were used. Under the latter two assumptions, net savings result only for prophylaxis initiated by day 4 after exposure. In the case of brucellosis, the use of a doxycycline-rifampin regimen (estimated 80% efficacy), a multiplication factor of 15 for unnecessary prophylaxis, and a discount rate of either 3% or 5% generated net losses regardless of when intervention began (Figure 2). The doxycycline-gentamicin regimen (estimated 95% efficacy) generated net losses only when it was assumed that the start of a program was delayed until 113 or more days after exposure. [Figure 2] [Figures not available in ASCII version] Figure 2. Ranges(a) of net savings due to postattack prophylaxis by disease and day of prophylaxis program initiation. (a)Maximum savings (l) were calculated by assuming a 95% effectiveness prophylaxis regimen and a 3% discount rate in determining the present value of expected lifetime earnings lost due to premature death (16) and a multiplication factor of 5 to adjust for unnecessary prophylaxis. Minimum savings (n) were calculated by assuming an 80% to 90% effectiveness regimen and a 5% discount rate and a multiplication factor of 15. In tularemia prophylaxis programs initiated on days 4-7 postattack, the minimum savings were calculated by assuming a 95% prophylaxis regimen effectiveness rather than an effectiveness of 80% to 90%. Preparedness: Insurance The annual actuarially fair premium that can be justifiably spent on intelligence gathering and other attack prevention measures increases with the probability that a bioterrorist attack can be decreased by such measures (Table 4). However, the potential net savings attributed to reduced probability are minor compared with the potential net savings from implementing a prophylaxis program. Depending on the level of protection that can be achieved, the annual actuarially fair premium in an anthrax scenario would be $3.2 million to $223.5 million (Table 4). The lower premium would be justifiable for measures that could reduce the risk for an attack from 0.01 to 0.001 and provide the ability to mount an intervention program within 6 days of the attack. The higher premium would be justifiable for measures that could reduce the risk from 0.01 to 0.00001 and allow immediate intervention if an attack occurred. Table 4. The maximum annual actuarially fair premium(a) by reduction in probability of event and size of avoided loss: Anthrax --------------------------------------------------------------------------- Actuarially fair annual premium ($ millions) ------------------------------------- Days Preventable 0.01 0.01 0.01 post- loss tp to to attack(b) ($millions) 0.001 0.0001 0.00001 --------------------------------------------------------------------------- Maximum loss estimate(c) 0 22,370.5 201.3 221.5 223.5 1 20,129.4 181.2 199.3 201.1 2 15,881.5 142.9 157.2 158.7 3 8,448.0 76.0 83.6 84.4 4 4,200.1 37.8 41.6 42.0 5 2,076.1 18.7 20.6 20.7 6 1,013.8 9.1 10.0 10.1 Minimum loss estimate(d) 0 14,372.4 128.9 141.8 143.1 1 12,820.1 115.4 126.9 128.1 2 10,049.1 90.4 99.5 100.4 3 5,200.1 46.8 51.5 51.9 4 2,429.7 21.9 24.1 24.3 5 1,004.2 9.4 10.3 10.4 6 351.2 3.2 3.5 3.5 --------------------------------------------------------------------------- (a)See text for definition. (b)No. of days from attack to effective initiation of prophylaxis. (c)Maximum loss preventable (potential net savings) occurs with the doxycycline-anthrax vaccine prophylaxis regimen, a multiplication factor of 5 for unnecessary prophylaxis, and a discount rate of 3% (Table 2). (d)Minimum loss preventable (potential net savings) occurs with the ciprofloxacin prophylaxis regimen, a multiplication factor of 15 for unnecessary prophylaxis, and a discount rate of 5% (Table 2). Sensitivity Analyses The upper estimates of the cost of hospitalization increased average costs per day by 18% to 22%, and upper estimates of the cost of outpatient visits increased average costs per day by 46% to 93% (Table 1). However, the upper estimates only increased medical costs by 1% to 6% of the total medical costs associated with a bioterrorist attack (Table 3). The largest increase was for brucellosis, for which upper estimates increased medical costs from 38% to 44% of total costs (Table 3). When the number of persons infected during an attack was reduced tenfold, the patient-related costs were reduced proportionately (Table 3). In most cases, however, the net savings in total costs are less than 10% of the net savings when 100% of the target population was presumed infected. The shortfall in savings is caused by an increase in the number of unexposed persons receiving prophylaxis. In the case of anthrax, when intervention programs are initiated within 3 days of exposure, savings are 4.1% to 10% of those in the original scenario (Figure 2). Delaying initiation of prophylaxis until days 4, 5, or 6 after exposure, however, results in net losses of $13.4 to $283.1 million. Losses occur regardless of prophylaxis regimen, discount rate, or multiplication factor used to adjust for unnecessary prophylaxis by unexposed persons. In scenarios in which a multiplication factor of 15 was used to adjust for unnecessary prophylaxis, the threshold value of intervention was always above the prophylaxis cost for anthrax but not above the prophylaxis costs for tularemia and brucellosis (Table 5). For tularemia, the threshold intervention costs exceeded disease costs up to day 5 in the scenario with 95% effectiveness and a 5% discount, and for brucellosis, at all levels in the scenarios with 80% effectiveness and up to day 56 in the scenarios with 95% effectiveness. This is consistent with the lower range of estimated net savings (net losses) given in Figure 2. Reducing the number of unexposed persons receiving prophylaxis increases the cost thresholds, making the program cost beneficial. For example, changing the multiplication factors for unnecessary prophylaxis to 5 and 10 increases the cost thresholds to $659 and $319, respectively, for a brucellosis prophylaxis program initiated 15 to 28 days after exposure, with a 5% discount rate. If a discount rate of 3% is used instead of 5%, the cost thresholds increase to $799 and $387. All these cost thresholds are above the estimated prophylaxis cost of $285 per person for the doxycycline-rifampin regimen and $161 per person for the doxycycline-gentamicin regimen (Table 2). Table 5. Cost thresholds(a) of interventions ($/person) by day of intervention initiation, prophylaxis effectiveness, and discount rates. -------------------------------------------------------------------------- Threshold costs for intervention ($/person, multiplication factor of 15(b)) Anthrax Tularemia Brucellosis Post- Disc. rate(c) Post- Disc. rate Post- Disc. rate attack attack attack day(d) 5% 3% day 5% 3% day 5% 3% -------------------------------------------------------------------------- 90% effectiveness(e) 80% effectiveness(e) 80% effectiveness(e) 0 9,838 14,238 0 1,891 2,633 0-7 233* 282* 1 8,851 12,809 1 1,873 2,609 8-14 224* 272* 2 7,022 10,162 2 1,599 2,227 15-28 211* 255* 3 3,775 5,463 3 756 1,053 29-56 179* 217* 4 1,893 2,739 4 258 366 57-112 86* 104* 5 944 1,366 5 79 110 113+ 24* 30* 6 468 677 6 20* 28 Prophylaxis cost(c) $226 $28 $285 95% effectiveness(e) 95% effectiveness(e) 95% effectiveness(e) 0 10,370 15,007 0 2,229 3,104 0-7 274 333 1 9,359 13,544 1 2,207 3,074 8-14 264 320 2 7,427 10,948 2 1,898 2,644 15-28 248 301 3 3,995 5,782 3 898 1,251 29-56 211 256 4 2,004 2,900 4 328 457 57-112 102* 124* 5 1,000 1,447 5 93* 131 113+ 29* 35* 6 496 718 6 23* 32* Prophylaxis cost(e) $238 $104 $161 -------------------------------------------------------------------------- *Threshold value is below estimated cost of prophylaxis. (a)Cost threshold is the point where cost of intervention and net savings due to the intervention are equal. (b)Multiplication factor to adjust for persons who participated in the prophylaxis program but were unexposed. (c)Applied to present value of expected future earnings and housekeeping services (weighted average for age and sex). (d)Postattack day on which prophylaxis was effecively implemented. (e)See Table 2 for prophylaxis regimens assumed to give the stated levels of effectiveness and cost/person of prophylaxis. Conclusions The economic impact of a bioterrorist attack can range from $477.7 million per 100,000 persons exposed in the brucellosis scenario to $26.2 billion per 100,000 persons exposed in the anthrax scenario (Table 3). These are minimum estimates. In our analyses, we consistently used low estimates for all factors directly affecting costs. The ID50 estimates for the three agents are twofold to 50-fold higher than previously published estimates (5,6,10,11), resulting in a possible understatement of attack rates. Also, in our analyses we did not include a number of other factors (e.g., long-term human illness or animal illnesses) (Table 6) whose cumulative effect would likely increase the economic impact of an attack. Our model shows that early implementation of a prophylaxis program after an attack is essential. Although the savings achieved by initiating a prophylaxis program on any given day after exposure has a wide range, a clear trend of markedly reduced savings is associated with delay in starting prophylaxis (Figure 2). This trend was found in the analysis of all three agents studied. Table 6. Potential factors affecting the economic impact of a bioterrorist attack --------------------------------------------------------------------------- Potential Relative impact on magnitude Factor net savings of impact --------------------------------------------------------------------------- Higher than projected Increase ++++ case-fatality rate Long term illness (physical Increase ++ and psychological) Decontamination and disposal Increase ++ of biohazardous waste Disruptions in commerce Increase ++ (local, national, and international) Animal illness and death Increase + Lower than projected Decrease - - - effectiveness of prophylaxis Adverse drug reactions due Decrease - to prophylaxis Postattack prophylaxis Decrease - distribution costs, including crowd control and security Training and other skill Decrease - maintenance costs Procurement and storage of Decrease - antimicrobial drugs and vaccines before attack Criminal investigations Variable +/- and court costs --------------------------------------------------------------------------- Delay in starting a prophylaxis program is the single most important factor for increased losses (reduced net savings). This observation was supported by the actuarially fair premium for preparedness analysis (Table 4). Reductions in preventable loss due to early intervention had significantly greater impact on the amount of an actuarially fair premium than reductions in probability of an attack through intelligence gathering and related activities. Although implemented at different times in a threat-attack continuum, both attack prevention measures and prophylaxis programs are forms of preventive medicine. Attack prevention measures seek to prevent infection, while prophylaxis programs prevent disease after infection has occurred. Using an actuarially fair premium analogy in which cost and benefit are required to be equal, we find that the incremental rate of increasing prevention effectiveness (the marginal increase) declines rapidly as probability reduction targets go from 0.001 to 0.0001 to 0.00001. Because the loss probability is decreasing on a logarithmic scale, the potential increment in marginal benefit drops comparably, resulting in ever smaller increments in the protection above the preceding base level. Conversely, delaying a prophylaxis program for anthrax, a disease with a short incubation period and a high death rate, increases the risk for loss in a manner akin to a semilogarithmic scale. Arithmetic increases in response time buy disproportionate increases in benefit (prevented losses.) The potential for reducing loss is great because an attack is assumed, thus increasing the actuarially fair premium available to prepare for and implement a rapid response. Large differences between prophylaxis costs and the threshold costs for most scenarios, particularly if prophylaxis is early (Table 5), suggest that the estimates of savings from prophylaxis programs are robust. Even with large increases in prophylaxis cost, net savings would still be achieved. The ability to rapidly identify persons at risk would also have significant impact on costs. For example, the threshold costs for brucellosis prophylaxis are often lower than intervention costs when the ratio of unexposed to exposed persons in the prophylaxis program is 15:1 (Table 5). This finding provides an economic rationale for preparedness to rapidly and accurately identify the population at risk and reduce unnecessary prophylaxis costs. The maximum amount of the annual actuarially fair premium varies directly with the level of risk reduction and the rapidity of postattack response (Table 4). The calculated amount of actuarially fair premiums, however, should be considered a lower bound estimate. A higher estimate (called the certainty equivalent) can also be calculated; however, this requires the determination of a social welfare function (22), and such complexity is beyond the scope of this study. Our model provides an economic rationale for preparedness measures to both reduce the probability of an attack and increase the capability to rapidly respond in the event of an attack. The larger portion of this preparedness budget (insurance premium) should be allocated to measures that enhance rapid response to an attack. These measures would include developing and maintaining laboratory capabilities for both clinical diagnostic testing and environmental sampling, developing and maintaining drug stockpiles, and developing and practicing response plans at the local level. These measures should be developed with a value-added approach. For example, the laboratory capability could be used for other public health activities in addition to preparedness, and drugs nearing their potency expiration date could be used in government-funded health care programs. However, these secondary uses should not undermine the preparedness program's effectiveness. Arnold Kaufmann is a retired Public Health Service officer, formerly assigned to the National Center for Infectious Diseases. Address for correspondence: Martin I. Meltzer, Mail Stop C-12, National Center for Infectious Diseases, Centers for Disease Control and Prevention, Atlanta, GA 30333; fax: 404-639-3039; e-mail: qzm4@cdc.gov. References 1. Cole LA. The specter of biological weapons. Sci Am 1996;275:60-5. 2. Gochenour WS. Aerobiology. Mil Med 1963;128:86-9. 3. Abramova FAN, Grinberg LM, Yampolskaya OV, Walker DH. Pathology of inhalational anthrax in 42 cases from the Sverdlovsk outbreak of 1979. Proc Natl Acad Sci 1993;90:2291-4. 4. Benenson AS, editor. Control of communicable diseases manual. 16th ed. Washington (DC): American Public Health Association, 1995. 5. Messelson M, Guillemin J, Hugh-Jones M, Langmuir A, Popova I, Shelokov A, et al. The Sverdlosvsk anthrax outbreak of 1979. Science 1994;266:1202-8. 6. Kaufmann AF, Fox MD, Boyce JM, Anderson DC, Potter ME, Martone WJ, et al. Airborne spread of brucellosis. Ann NY Acad Sci 1980;335:105-14. 7. Olle-Goig JE, Canela-Soler J. An outbreak of Brucella melitensis infection by airborne transmission among laboratory workers. Am J Public Health 1987;77:335-8. 8. Staszkiewicz J, Lewis CM, Colville J, Zervos M, Band J. Outbreak of Brucella melitensis among microbiology laboratory workers in a community hospital. J Clin Microbiol 1991;29:287-90. 9. Trever RW, Cluff LE, Peeler RN, Bennett IL. Brucellosis I. laboratory-acquired acute infection. Arch Intern Med 1959;103:381-97. 10. McCrumb FR. Aerosol infection of man with Pasteurella tularensis. Bacteriolical Reviews 1961;25:262-7. 11. Saslaw S, Eigelsbach HT, Wilson HR, Prior JA, Carhart S. Tularemia vaccine study II. respiratory challenge. Arch Intern Med 1961;107:689-701. 12. Friedlander AM, Welkos SL, Pitt MLM, Ezzell JW, Worsham PL, Rose, KJ, et al. Postexposure prophylaxis against experimental inhalation anthrax. J Infect Dis 1993;167:1239-42. 13. Sawyer WD, Dangerfield HG, Hogge AL, Crozier D. Antibiotic prophylaxis and therapy of airborne tularemia. Bacteriolical Reviews 1966;30:542-8. 14. Solera J, Rodriguez-Zapata M, Geijo P, Largo J, Paulino J, Saez L, et al. Doxycycline-rifampin versus doxycycline-streptomycin in treatment of human brucellosis due to Brucella melitensis. Antimicrob Agents Chemother 1995;39:2061-7. 15. Luce BR, Manning WG, Siegel JE, Lipscomb J. Estimating costs in cost-effectiveness analysis. In: Gold MR, Siegel JE, Russell LB, Weinstein MC, editors. Cost-effectiveness in health and medicine. New York: Oxford University Press, 1966:176-213. 16. Haddix AC, Teutsch SM, Shaffer PA, Dunet DO, editors. Prevention effectiveness: a guide to decision analysis and economic evaluation. New York: Oxford University Press, 1996. 17. Lipscomb J, Weinstein MC, Torrance GW. Time preference. In: Gold MR, Siegel JE, Russell LB, Weinstein MC, editors. Cost-effectiveness in health and medicine. New York: Oxford University Press, 1966:214-35. 18. U.S. Bureau of the Census. Statistical abstract of the United States: 1995. 115th ed. Washington (DC): U.S. Government Printing Office, 1996. 19. National Center for Health Statistics. Health, United States, 1995. Hyattsville (MD):U.S.Departmentof Health and Human Services, Public Health Service, 1996. 20. HealthCare Consultants of America, Inc. HealthCare Consultants' 1996 physicians fee and coding guide. 6th ed. Augusta (GA): HealthCare Consultants of America, Inc. 1996. 21. Cardinale V, editor. 1996 Drug Topics Red Book. Montvale (NJ): Medical Economics Company, Inc., 1996. 22. Robison LJ, Barry PJ. The competitive firm's response to risk. New York: Macmillan, 1987. --------------------------------------------------------------------------- [Emerging Infectious Diseases * Volume 3 * Number 2 * April-June 1997] Synopses Hantaviruses: A Global Disease Problem Connie Schmaljohn* and Brian Hjelle† *United States Army Medical Research Institute of Infectious Diseases, Fort Detrick, Frederick, Maryland, USA; and †University of New Mexico, Albuquerque, New Mexico, USA --------------------------------------------------------------------------- Hantaviruses are carried by numerous rodent species throughout the world. In 1993, a previously unknown group of hantaviruses emerged in the United States as the cause of an acute respiratory disease now termed hantavirus pulmonary syndrome (HPS). Before then, hantaviruses were known as the etiologic agents of hemorrhagic fever with renal syndrome, a disease that occurs almost entirely in the Eastern Hemisphere. Since the discovery of the HPS-causing hantaviruses, intense investigation of the ecology and epidemiology of hantaviruses has led to the discovery of many other novel hantaviruses. Their ubiquity and potential for causing severe human illness make these viruses an important public health concern; we reviewed the distribution, ecology, disease potential, and genetic spectrum. The genus Hantavirus, family Bunyaviridae, comprises at least 14 viruses, including those that cause hemorrhagic fever with renal syndrome (HFRS) and hantavirus pulmonary syndrome (HPS) (Table 1). Several tentative members of the genus are known, and others will surely emerge as their natural ecology is further explored. Hantaviruses are primarily rodent-borne, although other animal species harboring hantaviruses have been reported. Unlike all other viruses in the family, hantaviruses are not transmitted by arthropod vectors but (most frequently) from inhalation of virus-contaminated aerosols of rodent excreta (1). Human-to-human transmission of hantaviruses has not been documented, except as noted below. Table 1. Members of the genus Hantavirus, family Bunyaviridae -------------------------------------------------------------------------- Species Disease Principal Distribution Distribution of Reservoir of Virus Reservoir -------------------------------------------------------------------------- Hantaan (HTN) HFRS(a) Apodemus China, C Europe south to agrarius Russia, Thrace, Caucasus, (striped field Korea & Tien Shan Mtns; mouse) Amur River through Korea to E Xizang & E Yunnan, W Sichuan, Fujiau, & Taiwan(China) Dobrava-Belgrade HFRS Apodemus Balkans England & Wales, (DOB) flavicollis from NW Spain, (yellow-neck France, S mouse) Scandinavia through European Russia to Urals, S Italy, the Balkans, Syria, Lebanon, & Israel Seoul (SEO) HFRS Rattus Worldwide Worldwide norvegicus (Norway rat) Puumala (PUU) HFRS Clethrionomys Europe, W Palearctic from glareolus Russia, France and (bank vole) Scandinavia Scandinavia to Lake Baikai, south to N Spain, N Italy, Balkans,W Turkey, N Kazakhstan, Altai & Sayan Mtns; Britain & SW Ireland Thailand (THAI) nd(b) Bandicota Thailand Sri Lanka, indica peninsular India (bandicoot rat) to Nepal, Burma, NE India, S China, Laos, Taiwan, Thailand, Vietnam Prospect Hill nd Microtus U.S., Canada C Alaska to (PH) pennsylvanicus Labrador, (meadow vole) including Newfoundland & Prince Edward Island, Canada; Rocky Mountains to N New Mexico, in Great Plains to N Kansas, & in Appalachians to N Georgia, U.S. Khabarovsk (KHB) nd Microtus fortis Russia Transbaikalia Amur (reed vole) region; E China Thottapalayam nd Suncus murinus India Afghanistan, (TPM) (musk shrew) Pakistan, India, Sri Lanka, Nepal, Bhutan, Burma, China, Taiwan, Japan, Indomalayan Region Tula (TUL) nd Microtus Europe Throughout Europe arvalis to Black Sea & NE (European to Kirov region, common Russia vole) Sin Nombre (SN) HPS(c) Peromyscus U.S., Alaska Panhandle maniculatus Canada, across N Mexico (deer mouse) Canada, south through most of continental U.S., excluding SE & E seaboard, to southernmost Baja California Sur and to NC Oaxaca, Mexico New York (NY) HPS Peromyscus U.S. C and E U.S. to S leucopus Alberta & S (white-footed Ontario, Quebec & mouse) Nova Scotia, Canada; to N Durango & along Caribbean coast to Isthmus of Tehuantepec & Yucatan Peninsula, Mexico Black Creek HPS Sigmodon U.S. SE U.S., from S Canal hispidus Nebraska to C (BCC) (cotton rat) Virginia south to SE Arizona & peninsular Florida; interior & E Mexico through Middle America to C Panama; in South Amer ica to N Colombia & N Venezuela El Moro Canyon nd Reithrodontomys U.S., Mexico British Columbia & (ELMC)(d) SE Alberta, megalotis Canada; W and NC (Western U.S., S to N Baja harvest mouse) California & interior Mexico to central Oaxaca Bayou (BAY)(d) HPS Oryzomys U.S. SE Kansas to E palustris Texas, eastward to (rice rat) S New Jersey & peninsular Florida -------------------------------------------------------------------------- Probable species:(e) -------------------------------------------------------------------------- Topografov (TOP) nd Lemmus Siberia Palearctic, from sibiricus White Sea, W (Siberian Russia, to lemming) Chukotski Peninsula, NE Siberia, & Kamchatka; Nearctic, from W Alaska E to Baffin Island & Hudson Bay, S Rocky Mtns to C B.C., Canada Andes (AND)(d) HPS Oligoryzomys Argentina NC to S Andes, longicaudatus(f) approximately to 50 deg S latitude, (long-tailed in Chile & pygmy Argentina rice rat) To be named(d) HPS Calomys laucha Paraguay N Argentina & vesper mouse Uruguay, SE Bolivia, W Paraguay, and WC Brazil Isla Vista nd Microtus U.S. Pacific coast, (ISLA)(d) californicus from SW Oregon (California through vole) California, U.S., to N Baja California, Mexico Bloodland Lake nd Microtus U.S. N & C Great (BLL)(d) ochrogaster Plains, EC Alberta (prairie vole) to S Manitoba, Canada, S to N Oklahoma & Arkansas, E to C Tennessee & W West Virginia, U.S.; relic populations elsewhere in U.S. & Mexico Muleshoe nd Sigmodon U.S. See Black Creek (MUL)(d) hipidus Canal (cotton rat) Rio Segundo nd Reithrodontomys Costa Rica S Tamaulipas & WC (RIOS)(d) Michoacan, Mexico, mexicanus S through Middle (Mexican American highlands harvest mouse) to W Panama; Andes of W Colombia & N Ecuador Rio Mamore nd Oligoryzomys Bolivia C Brazil south of (RIOM)(d) microtis Rios Solimoes- (small-eared Amazon & pygmy contiguous low rice rat) lands of Peru, Bolivia, Paraguay, & Argentina. -------------------------------------------------------------------------- (a)HFRS, hemorrhagic fever with renal syndrome (b)nd, none documented (c)HPS, hantavirus pulmonary syndrome (d) not yet isolated in cell culture (e) viruses for which incomplete characterization is available, but for which there is clear evidence indicating that they are unique (f) suspected host, but not confirmed Adapted from (57,72) and from (9,13,23,38,42,43,50-71) The recognition of a previously unknown group of hantaviruses as the cause of HPS in 1993 is an example of virus emergence due to environmental factors favoring of the natural reservoir; a larger reservoir increases opportunities for human infection. We reviewed the global distribution of hantaviruses, their potential to cause disease, and their relationships to each other and to their rodent hosts. History of HFRS and HPS "Hemorrhagic fever with renal syndrome" denotes a group of clinically similar illnesses that occur throughout the Eurasian landmass and adjoining areas (2,3). HFRS includes diseases previously known as Korean hemorrhagic fever, epidemic hemorrhagic fever, and nephropathia epidemica (4). Although these diseases were recognized in Asia perhaps for centuries, HFRS first came to the attention of western physicians when approximately 3,200 cases occurred from 1951 to 1954 among United Nations forces in Korea (2,5). Other outbreaks of what is believed to have been HFRS were reported in Russia in 1913 and 1932, among Japanese troops in Manchuria in 1932 (2,6), and in Sweden in 1934 (7,8). In the early 1940s, a viral etiology for HFRS was suggested by Russian and Japanese investigators who injected persons with filtered urine or serum from patients with naturally acquired disease (2). These studies also provided the first clues to the natural reservoir of hantaviruses: the Japanese investigators claimed to produce disease in humans by injecting bacteria-free filtrates of tissues from Apodemus agrarius or mites that fed on the Apodemus mice. Mite transmission was never conclusively demonstrated by other investigators, and it was not until 1978 that a rodent reservoir for HFRS-causing viruses was confirmed by investigators who demonstrated that patient sera reacted with antigen in lung sections of wild-caught Apodemus agrarius and that the virus could be passed from rodent to rodent (9). The successful propagation of Hantaan (HTN) virus in cell culture in 1981 provided the first opportunity to study this pathogen systematically (10). The history of HFRS has been explored (2,11,12). HPS was first described in 1993 when a cluster of cases of adult fatal respiratory distress of unknown origin occurred in the Four Corners region of the United States (New Mexico, Arizona, Colorado, and Utah). The unexpected finding that sera from patients reacted with hantaviral antigens was quickly followed by the genetic identification of a novel hantavirus in patients' tissues and in rodents trapped near patients' homes (13-15). Prevalence and Clinical Course Approximately 150,000 to 200,000 cases of HFRS involving hospitalization are reported each year throughout the world, with more than half in China (16). Russia and Korea also report hundreds to thousands of HFRS cases each year. Most remaining cases (hundreds per year) are found in Japan, Finland, Sweden, Bulgaria, Greece, Hungary, France, and the Balkan countries formerly constituting Yugoslavia (16). Depending in part on which hantavirus is responsible for the illness, HFRS can appear as a mild, moderate, or severe disease (Table 2). Death rates range from less than 0.1% for HFRS caused by Puumala (PUU) virus to approximately 5% to 10% for HFRS caused by HTN virus (16). The clinical course of severe HFRS involves five overlapping stages: febrile, hypotensive, oliguric, diuretic, and convalescent; it is not uncommon, however, for one or more of these stages to be inapparent or absent. The onset of the disease is usually sudden with intense headache, backache, fever, and chills. Hemorrhage, if it occurs, is manifested during the febrile phase as a flushing of the face or injection of the conjunctiva and mucous membranes. A petechial rash may also appear, commonly on the palate and axillary skin folds. Sudden and extreme albuminuria, around day 4, is characteristic of severe HFRS. As the febrile stage ends, hypotension can abruptly develop and last for hours or days, during which nausea and vomiting are common. One-third of deaths occur during this phase because of vascular leakage and acute shock. Almost half of all deaths occur during the subsequent (oliguric) phase because of hypervolemia. Patients who survive and progress to the diuretic phase show improved renal function but may still die of shock or pulmonary complications. The final (convalescent) phase can last weeks to months before recovery is complete (3,5,12). Table 2. Distinguishing clinical characteristics for HFRS and HPS -------------------------------------------------------------------------- Disease Pathogens Distinguishing Characteristics* -------------------------------------------------------------------------- HFRS (moderate-severe) HTN, SEO, hemorrhage +++ Death rate DOB azotemia/ 1%-15% proteinuria +++/++++ pulmonary capillary leak +/++ myositis +/+++ conjunctival injection ++/++++ eye pain/myopia ++/++++ HFRS (mild) PUU hemorrhage + Death rate <1% azotemia/ proteinuria +/++++ pulmonary capillary leak -/+ myositis + conjunctival injection + eye pain/myopia ++/++++ HPS (prototype) SN, NY hemorrhage + Death rate >40% zotemia/ proteinuria + pulmonary capillary leak ++++ myositis - conjunctival injection -/+ eye pain/myopia - HPS (renal BAY, BCC, hemorrhage + variant) Andes azotemia/ Death rate>40% proteinuria ++/+++ pulmonary capillary leak +++/++++ myositis ++/++++ conjunctival injection -/++ eye pain/myopia - -------------------------------------------------------------------------- *Minimum/maximum occurrence of the characteristic: - rarely reported; + infrequent or mild manifestation; ++, +++, ++++ more frequent and severe manifestation. More than 250 cases of HPS have been reported throughout North and South America. Although the disease has many features (e.g., a febrile prodrome, thrombocytopenia, and leukocytosis) in common with HFRS (Table 2), in HPS capillary leakage is localized exclusively in the lungs, rather than in the retroperitoneal space, and the kidneys are largely unaffected. Most of the 174 cases of HPS in the United States and Canada have been caused by Sin Nombre (SN) virus. In HPS, death occurs from shock and cardiac complications, even with adequate tissue oxygenation. Cases of HPS in the southeastern United States, as well as many in South America, are caused by a newly recognized clade (a group that shares a common ancestor) of viruses that includes Bayou (BAY), Black Creek Canal (BCC), and Andes viruses. As with HFRS, clinical differences can be observed among patients with HPS caused by different hantaviruses. For example, although HPS due to SN virus infection can sometimes be associated with renal insufficiency after prolonged hypoperfusion, renal impairment is only rarely observed early in disease, and chemical evidence of skeletal muscle inflammation (increased serum levels of the muscle enzyme creatine kinase) is rare (17). In contrast, both renal insufficiency and elevated creatine kinase levels are observed at much higher frequency, although not universally, with Andes, BAY, and BCC virus infections (18-20; J. Davis, J. Cortes, and C. Barclay, pers. comm.). In an outbreak of HPS recently described in Paraguay, a novel hantavirus, carried by Calomys laucha, was identified as the etiologic agent (21). The relationship of this virus to other HPS-causing hantaviruses remains to be established. Ecology and Epidemiology Hantavirus infection is apparently not deleterious to its rodent reservoir host and is associated with a brisk antibody response against the virion envelope and core proteins and chronic, probably lifelong infection. In natural populations, most infections occur through age-dependent horizontal route(s). The highest antibody prevalence is observed in large (mature) animals. A striking male predilection for hantavirus infection is observed in some rodent species such as harvest mice and deer mice, but not in urban rats (Rattus norvegicus) (22-24). Horizontal transmission among cage-mates was experimentally demonstrated (25), but vertical transmission from dam to pup is negligible or absent both in wild and experimental settings (22,24,25). Outbreaks of hantaviral disease have been associated with changes in rodent population densities, which may vary greatly across time, both seasonally and from year to year. Cycles respond to such extrinsic factors as interspecific competition, climatic changes, and predation. Spring and summer outbreaks of HFRS in agricultural settings in Asia and Europe are linked to human contact with field rodents through the planting and harvesting of crops (16,26). PUU outbreaks in Scandinavia and the HPS outbreak in the Four Corners region of the United States were associated with natural rodent population increases, followed by invasion of buildings by rodents (27,28). The ecologic events that led to 1994 and 1996 outbreaks of Andes virus-HPS in Patagonia, a region in southern South America, are being investigated. Human interventions, such as the introduction of Old World plant species (e.g., rosas mosquetas and Scottish brougham) to Patagonia, with associated alteration in rodent population dynamics, have been suggested as possible factors. Recent fires and a mild winter in Argentina's Rio Negro and Chubut Provinces may also have had a positive effect on the carrier rodent, the colilargo, Oligoryzomys longicaudatus (M. Christie and O. Pearson, pers. comm.). Although the aerosol route of infection is undoubtedly the most common means of transmission among rodents and to humans, virus transmission by bite may occur among certain rodents (29) and may also occasionally result in human infection (30) (often inside a closed space, such as a rodent-infested grain silo, garage, or outbuilding used for food storage). Epidemiologic investigations have linked virus exposure to such activities as heavy farm work, threshing, sleeping on the ground, and military exercises. Indoor exposure was linked to invasion of homes by field rodents during cold weather or to nesting of rodents in or near dwellings (16,31). Genetic sequencing of rodent- and patient-associated viruses has been used to pinpoint the precise locations of human infections, which has supported the role of indoor exposure in hantavirus transmission (32,33). Many hantavirus infections have occurred in persons of lower socioeconomic status because poorer housing conditions and agricultural activities favor closer contact between humans and rodents. However, suburbanization, wilderness camping, and other outdoor recreational activities have spread infection to persons of middle and upper incomes. Nosocomial transmission of hantaviruses has not been documented until very recently (34) and must be regarded as rare. However, viruses have been isolated from blood and urine of HFRS patients, so exposure to bodily fluids of infected persons could result in secondary transmission. Only rarely have multiple North American HPS cases been associated with particular households or buildings. During recent outbreaks of HPS in South America, however, clustering of cases in households and among personal contacts appeared to be more common (M. Christie, pers. comm.). During a recent outbreak of Andes-virus-associated HPS in Patagonia, a Buenos Aires physician apparently contracted the infection after minimal exposure to infected patient blood (34; D.A. Pirola, pers. comm.). An adolescent patient in Buenos Aires apparently contracted hantavirus infection from her parents, who were infected in Patagonia. This unprecedented observation of apparent person-to-person spread of a hantavirus clearly requires laboratory confirmation, especially by careful comparative analysis of the viral sequences (32,33). Hantaviruses have also caused several laboratory-associated outbreaks of HFRS. Laboratory-acquired infections were traced to persistently infected rats obtained from breeders (35-37), to wild-caught, naturally infected rodents (38-40), or to experimentally infected rodents (39). No illnesses due to laboratory infections have been reported among workers using cell-culture adapted viruses, although asymptomatic seroconversions have been documented (40). Hantavirus Distribution and Disease-causing Potential The worldwide distribution of rodents known to harbor hantaviruses (Table 1) suggests great disease-causing potential. Each hantavirus appears to have a single predominant natural reservoir. With rare exception, the phylogenetic interrelationships among the viruses and those of their predominant host show remarkable concordance (Figure; 41). These observations suggest that hantaviruses do not adapt readily to new hosts and that they are closely adapted for success in their host, possibly because of thousands of years of coexistence. As many as three hantaviruses can be found in a particular geographic site, each circulating in its own rodent reservoir, with no apparent evolutionary influence on one another (42). [Figure 1] [Figures not available in ASCII version] Figure. Phylogeny of hantaviruses and their relationships to natural reservoirs. The trees were constructed by comparing the complete coding regions of the S segments of hantaviruses or of 330 nucleotides corresponding to those of the M segment of Hantaan virus (strain 76118) from nucleotides 1987 to 2315. Abrreviations for viruses are as in Table 1. For each analysis, a single most parsimonious tree was derived by using PAUP 3.1.1 software. For the S segment tree, boostrap values resulting from 100 replications were all greater than 87% except for the branch leading to BCC (78%) and the branch leading to DOB (52%). The next most common placing of DOB was on a branch with HTN. All known hantaviruses, except Thotta-palayam (TPM) virus, have been isolated or detected in murid rodents. Because only one isolate of TPM virus was made from a shrew (Order Insectivora), it is not clear if Suncus is the true primary reservoir or an example of a "spillover" host, i.e., a secondary host infected through contact with the primary host. Spillover is common in sympatric murid rodents, including those identified as the predominant carrier of another hantavirus; thus, the opportunity for genetic exchange among hantaviruses is present in nature. Spillover hosts are believed to have little or no impact on hantaviral distribution or associated disease. However, rodents other than the primary reservoirs can play an important carrier role. For example, Microtus rossiaemeri-dionalis may play a role in maintenance of Tula virus in some settings (43), and Peromyscus leucopus and Peromyscus boylii can be important reservoirs for SN virus in the western United States (T. Yates and B. Hjelle, unpub. data). Apparent spillover may also be the result of laboratory errors such as polymerase chain reaction (PCR) contamination or misidentification of rodent species. However, spillover is probably under-appreciated in many studies that rely on reverse transcriptase PCR for identifying specific viruses because many primer pairs may not detect an unexpected spillover virus. In either case, because mistaken identities and cell culture contaminations with other hantaviruses have occasionally been reported, investigators should verify unusual findings to prevent further confusion. Antigenic and Genetic Diversity among Hantaviruses Hantaviruses have been characterized by a combination of antigenic and genetic methods. For viruses propagated in cell culture, the plaque-reduction neutralization test is the most sensitive serologic assay for differentiation (44,45); nine hantaviruses have been defined by this test: HTN, Seoul (SEO), PUU, Prospect Hill, Dobrava-Belgrade (DOB), Thailand, TPM, SN, and BCC viruses (44-48). Genetic relationships among hantaviruses are mirrored in their antigenic properties. A direct correlation between genetic and antigenic relationships is difficult; however, it can be assumed that the plaque-reduction neutralization test measures differences in the M segment gene products, i.e., the G1 and G2 envelope glycoproteins. Comparing the deduced G1 and G2 amino acid sequences, therefore, may provide clues to the antigenic as well as genetic diversity among hantaviruses. Of characterized hantavirus isolates, SEO virus is the most genetically homogeneous. Isolates of SEO virus, regardless of their geographic origin, display M segment nucleotide and deduced amino acid sequence homologies of approximately 95%, and 99%, respectively (41,47). A reported exception, the R22 isolate from China, had a slightly lower homology; however, the original data suggest that an error in the nucleotide sequence, resulting in a frame shift reading error, may account for almost all of the additional changes. PUU virus isolates vary the most, with M segment nucleotide and amino acid sequence homologies of 83% and 94% observed between a Finnish and Russian isolate. HTN virus also appears to be quite stable in nature. Comparing the M segment sequences of prototype HTN virus (from Apodemus) and those of two human isolates obtained at a 6-year interval from HFRS patients in Korea produced nucleotide and deduced amino acid sequence homologies of 94% and 97%, respectively (48). For SN virus, comparing the complete M or S segment sequences of three strains from California or New Mexico produced homologies of 87% to 99%. Partial nucleotide sequence comparisons of the M or S segments of SN viruses from adjacent counties in California, detected in deer mice captured 19 years apart, were 97.5% homologous (49). Similarly, a retrospective analysis of archived tissue samples collected in Mono County, California, in 1983 showed viruses with partial M and S segment nucleotide sequence homologies of about 87% with SN from an 1993 HPS patient from New Mexico (50). In all cases, the amino acid sequences encoded by these genes differed between cognate proteins by much less than 5%. These values are similar to those observed among strains of HTN virus. Studies have just begun to appear in which the nature of quasispecies in natural rodent hosts is defined (43,51). Such investigations should provide more definitive data concerning the genetic diversity among hantaviruses in nature. Evolution of Hantaviruses Phylogenetic trees derived by comparing complete or partial S (Figure), M, or L segment nucleotide sequences (41,52,53) show two major lineages of hantaviruses, one leading to HTN, SEO, Thailand, and DOB viruses, and one leading to PUU, Prospect Hill, SN, and other New World hantaviruses. TPM virus, the first hantavirus isolated in cell culture (54), may be the most antigenically and genetically disparate member of the genus; however, comparison of the complete nucleotide sequence of the TPM S segment (A. Toney, B. Meyer, C. Schmaljohn, unpub. data) suggests that TPM virus is more closely related to HTN, SEO, and DOB viruses than to any of the other viruses in the genus (Figure). Nucleotide sequence homologies of the M and S segments of any two hantaviruses have approximately the same degree of divergence between each of the three segments, which suggests similar evolutionary rates for these two gene segments. A slightly higher homology among L segments sequenced to date perhaps indicates a greater need for conservation of either RNA or protein functions (47). Point mutations appear to account for most of the genetic drift among hantaviruses. Recombination has not been reported for hantaviruses, although segment reassortment within a particular species appears common (52,55). The exchange of gene segments is suggested to be nonrandom, with a higher propensity for M segment swapping, than for S or L (55). Whether it contributes to the pathogenesis of hantaviruses is not known, but reassortment certainly provides an avenue for more rapid accumulation of changes than could occur by point mutation. There is no evidence that reassortment can occur between different species of hantaviruses; however, this has not been studied systematically. Murid rodents have probably harbored inapparent hantavirus infections for thousands, perhaps millions of years. It is likely that the genus Hantavirus evolved in the Old World and that viruses were carried by rodents across the Bering land bridge when they migrated during the Oligocene, and into South America in the Pliocene (71). Humans are incidental hosts, the victims of spillover infections from the natural host rodents. One of the two major forms of hantaviral diseases is endemic in each hemisphere. Both HFRS and HPS can be divided into distinct clinical subtypes, and the viral strain is a key determinant of the severity and nature of the clinical abnormalities. Not covered in this review are clinical studies of HFRS and HPS patients, which suggest that pathogenesis may be immunologic and may be mediated by cytokine responses (72). New outbreaks with novel hantavirus strains are still being uncovered, especially in South America. However, the largest clinical caseload and largest number of deaths occur in Asia and Europe. Dr. Schmaljohn is chief, Department of Molecular Virology, USAMRID. Current research interests include the development of molecular vaccines for hantaviruses, filoviruses, and flaviviruses. Dr. Hjelle has been active in studies of the molecular biology, evolution, epidemiology, and clinical aspects of hantavirus disease. His laboratory is a reference diagnostic center for hantavirus infections of humans and animals and has recently received funding to develop innovative vaccine strategies against HPS and other emerging viral diseases. Address for correspondence: Connie Schmaljohn, Virology Division, USAMRID, Fort Detrick, Frederick, MD 21702-5011; fax: 301-619-2439; e-mail: cschmaljohn@detrick.army.mil References 1. Lee H, van der Groen G. Hemorrhagic fever with renal syndrome. Prog Med Virol 1989;36:62-102. 2. Gajdusek D. Virus hemorrhagic fevers. J Pediatr 1962;60:841-57. 3. World Health Organization. Haemorrhagic fever with renal syndrome: memorandum from a WHO meeting. Bull World Health Organ 1983;61:269-75. 4. Gajdusek DC, Goldfarb LG, Goldgaber D. Bibliography of hemorrhagic fever with renal syndrome. Second Edition. Bethesda (MD): National Institutes of Health; 1987 Pub No. 88-3603. 5. Smadel J. Epidemic hemorrhagic fever. Am J Public Health 1953;43:1327-30. 6. Casals J, Henderson BE, Hoogstraakm G. A review of Soviet viral hemorrhagic fevers. J Infect Dis 1969;122:437-53. 7. Zetterholm SG. Akuta nefriter simulerande akuta bukfall. Svenska Lakartidningen 1934;31. 8. Myhrman G. En njursjukdom med egenartad symptombild. Nord Med Tidskr 1934;7:793-4. 9. Lee H, Lee P, Johnson K. Isolation of the etiologic agent of Korean hemorrhagic fever. J Infect Dis 1978;137:298-308. 10. French G, Foulke R, Brand O, Eddy G. Korean hemorrhagic fever: propagation of the etiologic agent in a cell line of human origin. Science 1981;211:1046-8. 11. Traub R. Korean hemorrhagic fever. J Infect Dis 1978;138:267-72. 12. McKee K, LeDuc J, Peters C. Hantaviruses. In: Belshe RB, Belshe RB, editors. Textbook of human virology. St Louis: Mosby Year Book 1991:615-32. 13. Nichol ST, Spiropoulou CF, Morzunov S, Rollin PE, Ksiazek TG, Feldmann H, et al. Genetic identification of a hantavirus associated with an outbreak of acute respiratory illness. Science 1993;262:914-7. 14. Ksiazek TG, Peters CJ, Rollin PE, Zaki S, Nichol S, Spiropoulou C, et al. Identification of a new North American hantavirus that causes acute pulmonary insufficiency. Am J Trop Med Hyg 1995;52:117-23. 15. Schmaljohn AL, Li D, Negley DL, Bressler DS, Turell MJ, Korch GW, et al. Isolation and initial characterization of a newfound hantavirus from California. Virology 1995;206:963-72. 16. Lee HW. Epidemiology and pathogenesis of hemorrhagic fever with renal syndrome. In: Elliott RM, editor. The Bunyaviridae. New York: Plenum Press, 1996:253-67. 17. Duchin JS, Koster FT, Peters CJ, Simpson GL, Tempest B, Zaki SR, et al. Hantavirus pulmonary syndrome: a clinical description of 17 patients with a newly recognized disease. N Engl J Med 1994;330:949-55. 18. Khan AS, Spiropoulou CF, Morzunov S, Zaki SR, Kohn MA, Nawas SR, et al. Fatal illness associated with a new hantavirus in Louisiana. J Med Virol 1995;46:281-6. 19. Khan AS, Gaviria JM, Rollin PE, Hlady WG, Ksiazek TG, Armstrong LR, et al. Hantavirus pulmonary syndrome in Florida: association with the newly identified Black Creek Canal virus. Am J Med 1996;100:46-8. 20. Hjelle B, Goade D, Torrez-Martínez N, Lang-Williams M, Kim J, Harris RL, et al. Hantavirus pulmonary syndrome, renal insufficiency and myositis associated with infection by Bayou hantavirus. Clin Infect Dis 1996;23:495-500. 21. Williams R, Bryan R, Mills H, Palma I, Vera I, Velasquez F, et al. Hantavirus pulmonary syndrome in western Paraguay. Am J Trop Med Hyg 1996;55 (suppl), Abstract 30. 22. Mills J, Ksiazek T, Ellis B, Rollin P, Nichol S, Yates T, et al. Patterns of association with host and habitat: antibody reactivity with Sin Nombre virus in small mammals in the major biotic communities of the southwestern United States. Am J Trop Med Hyg. In press. 23. Hjelle B, Anderson B, Torrez-Martínez N, Song W, Gannon WF, L. YT. Prevalence and geographic genetic variation of hantaviruses of New World harvest mice (Reithrodontomys): identification of a divergent genotype from a Costa Rican Reithrodontomys mexicanus. Virology 1995;207:452-9. 24. Childs J, Korch G, Glass G, LeDuc J, Shah K. Epizootiology of hantavirus infections in Baltimore: isolation of a virus from Norway rats and characteristics of infected rat populations. Am J Epidemiol 1987;126:55-68. 25. Lee H, Lee P, Baek L, Song C, Seong I. Intraspecific transmission of Hantaan virus, etiologic agent of Korean hemorrhagic fever, in the rodent Apodemus agrarius. Am J Trop Med Hyg 1981;30:1106-12. 26. Chen H-X, Qiu F-X, Dong B-J, Ji S-Z, Li Y-T, Wang Y, et al. Epidemiologic studies on hemorrhagic fever with renal syndrome in China. J Infect Dis 1986;154:394-8. 27. Niklasson B, LeDuc J. Epidemiology of nephropathia epidemica in Sweden. J Infect Dis 1987;155:269-76. 28. Parmenter R, Vigil R. The hantavirus epidemic in the southwest: an assessment of autumn rodent densities and population demographics in central and northern New Mexico. Atlanta (GA): 1993 Report to the Federal Centers for Disease Control and Prevention. 29. Glass G, Childs J, Korch G, LeDuc J. Association of intraspecific wounding with hantaviral infection in wild rats (Rattus norvegicus). Epidemiol Infect 1988;101:459-72. 30. Dournon E, Moriniere B, Matheron S, Girard P, Gonzalez J, Hirsch F, et al. HFRS after a wild rodent bite in the hautesavoie--and risk of exposure to Hantaan-like virus in Paris laboratory. Lancet 1984;1:676-7. 31. Armstrong L, Zaki S, Goldoft M, Todd R, Khan A, Khabbaz R, et al. Hantavirus pulmonary syndrome associated with entering or cleaning rarely used, rodent-infested structures. J Infect Dis 1995;172:1166. 32. Hjelle B, Torrez-Martínez N, Koster FT, Jay M, Ascher MS, Brown T, et al. Epidemiologic linkage of rodent and human hantavirus genomic sequences in case investigations of hantavirus pulmonary syndrome. J Infect Dis 1996;173:781-6. 33. Jay M, Hjelle B, Davis R, Ascher M, Baylies HN, Reilly K, et al. Occupational exposure leading to hantavirus pulmonary syndrome in a utility company employee. Clin Infect Dis 1996;22:841-4 34. Enria D, Padula P, Segura EL, Pini N, Edelstein A, Riva Posse C, et al. Hantavirus pulmonary syndrome in Argentina: possibility of person to person transmission. Medicina (B. Aires) 1996;56:709-11. 35. Umenai T, Lee P, Toyoda T, Yoshinaga K, Lee H, Saito T, et al. Korean hemorrhagic fever in staff in an animal laboratory. Lancet 1979;1:1314-6. 36. Desmyter J, LeDuc J, Johnson K, Brasseur F, Deckers C, Van Ypersele de Strihou C. Laboratory rat associated outbreak of haemorrhagic fever with renal syndrome due to Hantaan-like virus in Belgium. Lancet 1983;2:1445-8. 37. Lloyd G, Bowen E, Jones N. HFRS outbreak associated with laboratory rats in UK. Lancet 1984;May:1775-6. 38. Brummer-Korvenkontio M, Vaheri A, von Bonsdorff C-H, Vuorimies J, Manni T, Penttinen K, et al. Nephropathia epidemica: detection of antigen in bank voles and serologic diagnosis of human infection. J Infect Dis 1980;141:131-4. 39. Lee H, Johnson K. Laboratory-acquired infections with hantaan virus, the etiologic agent of Korean hemorrhagic fever. J Infect Dis 1982;146:645-51. 40. Centers for Disease Control and Prevention. Laboratory management of agents associated with hantavirus pulmonary syndrome: interim biosafety guidelines. MMWR Morb Mortal Wkly Rept 1994; 43:RR-7,1-2. 41. Xiao SY, Leduc JW, Chu YK, Schmaljohn CS. Phylo-genetic analyses of virus isolates in the genus Hantavirus, family Bunyaviridae. Virology 1994;198:205-17. 42. Rawlings J, Torrez-Martínez N, Neill S, Moore G, Hicks B, Pichuantes S, et al. Cocirculation of multiple hantaviruses in Texas, with characterization of the S genome of a previously-undescribed virus of cotton rats (Sigmodon hispidus). Am J Trop Med Hyg 1996;55:672-9. 43. Plyusnin A, Vapalahti O, Lankinen H, Lehvaslaiho H, Apekina N, Myasnikov Y, et al. Tula virus: a newly detected hantavirus carried by European common voles. J Virol 1994;68:7833-9. 44. Schmaljohn C, Hasty S, Dalrymple J, LeDuc J, Lee H, von Bonsdorff C-H, et al. Antigenic and genetic properties of viruses linked to hemorrhagic fever with renal syndrome. Science 1985;227:1041-4. 45. Chu Y-K, Rossi C, LeDuc J, Lee H, Schmaljohn C, Dalrymple J. Serological relationships among viruses in the Hantavirus genus, family Bunyaviridae. Virology 1994;198:196-204. 46. Chu Y-K, Jennings G, Schmaljohn A, Elgh F, Hjelle B, Lee HW, et al. Cross-neutralization of hantaviruses with immune sera from experimentally-infected animals and from hemorrhagic fever with renal syndrome and hantavirus pulmonary syndrome patients. J Infect Dis 1995;172:1581-4. 47. Schmaljohn CS. Molecular Biology of Hantaviruses. In: Elliott RM, editor. The Bunyaviridae. New York: Plenum Press, 1996:63-90. 48. Schmaljohn C, Arikawa J, Hasty S, Rasmussen L, Lee WH, Lee PW, Dalrymple J. Conservation of antigenic properties and sequences encoding the envelope proteins of prototype hantaan virus and two virus isolates from Korean haemorrhagic fever patients. J Gen Virol 1988;69:1949-55. 49. Jay M, Ascher MS, Chomel BB, Madon M, Sesline D, Enge B, et al. Sero-epidemiological studies of hantavirus infection among wild rodents in California. Emerg Infect Dis 1997;3. 50. Nerurkar VR, Song JW, Song KJ, Nagle JW, Hjelle B, Jenison S, et al. Genetic evidence for a hantavirus enzootic in deer mice (Peromyscus maniculatus) captured a decade before the recognition of hantavirus pulmonary syndrome. Virology 1994;204:563-8. 51. Rowe JE, St Jeor SC, Riolo J, Otteson EW, Monroe MC, Henderson WW, et al. Coexistence of several novel hantaviruses in rodents indigenous to North America. Virology 1995;213:122-30. 52. Li D, Schmaljohn A, Anderson K, Schmaljohn C. Complete nucleotide sequences of the M and S segments of two hantavirus isolates from California: evidence for reassortment in nature among viruses related to hantavirus pulmonary syndrome. Virology 1995;206:973-83. 53. Spiropoulou CF, Morzunov S, Feldmann H, Sanchez A, Peters CJ, Nichol ST. Genome structure and variability of a virus causing hantavirus pulmonary syndrome. Virology 1994;200:715-23. 54. Carey D, Reuben R, Panicker K, Shope R, Myers R. Thottapalayam virus: a presumptive arbovirus isolated from a shrew in India. Indian J Med Res 1971;59:1758-60. 55. Henderson WW, Monroe MC, St Jeor SC, Thayer WP, Rowe JE, Peters CJ, et al. Naturally occurring Sin Nombre virus genetic reassortants. Virology 1995;214:602-10. 56. Hjelle B, Jenison S, Torrez-Martínez N, Yamada T, Nolte K, Zumwalt R, et al. A novel hantavirus associated with an outbreak of fatal respiratory disease in the southwestern United States: evolutionary relation-ships to known hantaviruses. J Virol 1994;68:592-6. 57. Hjelle B, Jenison S, Goade D, Green W, Feddersen R, Scott A. Hantaviruses: clinical, microbiologic, and epidemiologic aspects. Crit Rev Clin Lab Sci 1995;32:469-508. 58. Avsic-Zupanc T, Xiao SY, Stojanovic R, Gligic A, van der Groen G, LeDuc JW. Characterization of Dobrava virus: a Hantavirus from Slovenia, Yugoslavia. J Med Virol 1992;38:132-7. 59. Lee H, Baek L, Johnson K. Isolation of hantaan virus, the etiologic agent of Korean hemorrhagic fever from wild urban rats. J Infect Dis 1982;146:638-44. 60. Elwell M, Ward G, Tingpalapong M, LeDuc J. Serologic evidence of hantaan-like virus in rodents and man in Thailand. Southeast Asian J Trop Med Public Health 1985;16:349-54. 61. Lee P, Amyx H, Yanagihara R, Gajdusek D, Goldgaber D, Gibbs C Jr. Partial characterization of Prospect Hill virus isolated from meadow voles in the United States. J Infect Dis 1985;152:826-9. 62. Hörling J, Chizhikov V, Lundkvist Å, Jonsson M, Ivanov L, Dekonenko A, et al. Khabarovsk virus: a phylogenetically and serologically distinct hantavirus isolated from Microtus fortis trapped in far-east Russia. J Gen Virol 1996;77:687-94. 63. Elliott LH, Ksiazek TG, Rollin PE, Spiropoulou CF, Morzunov S, Monroe M, et al. Isolation of the causative agent of hantavirus pulmonary syndrome. Am J Trop Med Hyg 1994;51:102-8. 64. Song J-W, Baek L-J, Gajdusek DC, Yanagihara R, Gavrilovskaya I, Luft BJ, et al. Isolation of pathogenic hantavirus from white footed mouse (Peromyscus leucopus). Lancet 1994;344:1637. 65. Ravkov EV, Rollin PE, Ksiazek TG, Peters CJ, Nichol ST. Genetic and serologic analysis of Black Creek Canal virus and its association with human disease and Sigmodon hispidus infection. Virology 1995;210:482-9. 66. Torrez-Martínez N, Song W, Hjelle B. Nucleotide sequence analysis of the M genomic segment of El Moro Canyon hantavirus: antigenic distinction from Four Corners hantavirus. Virology 1995;211:336-8. 67. Morzunov SP, Feldmann H, Spiropoulou CF, Semenova VA, Rollin PE, Ksiazek TG, et al. A newly recognized virus associated with a fatal case of hantavirus pulmonary syndrome in Louisiana. J Virol 1995;69:1980-3. 68. Plyusnin A, Vapalahti O, Lundkvist A, Henttonen H, Vaheri A. Newly recognised hantavirus in Siberian lemmings [letter]. Lancet 1996;347:1835. 69. López N, Padula P, Rossi C, Lázaro ME, Franze-Fernández MT. Genetic identification of a new hantavirus causing severe pulmonary syndrome in Argentina. Virology 1996;220:223-6. 70. Song W, Torrez-Martínez N, Irwin W, Harrison J, Davis R, Ascher M, et al. Isla Vista virus: a genetically novel hantavirus of the California vole Microtus californicus. J Gen Virol 1995;76:3195-9. 71. Hjelle B, Torrez-Martínez N, Koster FT. Hantavirus pulmonary syndrome-related virus from Bolivia. Lancet 1996;347:57. 72. Mertz G, Hjelle B, Bryan R. Hantavirus infection. In: Fauci A, Schrier R, editors. Advances in internal medicine. Chicago: Mosby Year Book Inc., 1996:373-425. --------------------------------------------------------------------------- [Emerging Infectious Diseases * Volume 3 * Number 2 * April-June 1997] Synopses Japanese Spotted Fever: Report of 31 Cases and Review of the Literature Fumihiko Mahara Mahara Hospital, Tokushima, Japan --------------------------------------------------------------------------- This article is also available in Japanese. The Japanese version can be accessed at http://www.cdc.gov/ncidod/EID/eid.htm Spotted fever group (SFG) rickettsioses, which are transmitted by ticks, were long thought not to exist in Japan. Three clinical cases of Japanese spotted fever (JSF) were first reported in 1984. The causative agent was isolated and named Rickettsia japonica. Through October 1996, 31 cases were diagnosed as JSF in Tokushima Prefecture. Infected patients typically had acute high fever, headache, and characteristic exanthema; eschar was observed in 90%. After the discovery of JSF, more than a hundred cases were reported in southwestern and central Japan. Recent surveys show ticks to be the most probable vectors. As an emerging infectious disease, JSF is not commonly recognized by clinicians; therefore, even though it has not caused fatal cases, it merits careful monitoring. The spotted fever group (SFG) rickettsioses, which are transmitted by ticks, have a worldwide distribution. Japanese spotted fever (JSF) is one of the newcomers of this group (1); the first clinical cases were reported in 1984 (2). The causative agent was isolated and named Rickettsia japonica (3). Because outbreaks were sporadic and limited, clinical reports concerning JSF, especially from specialists in dermatology and physiology and from general practitioners, were scarce. JSF was first found in Tokushima Prefecture, on the island of Shikoku in southwestern Japan; Tsutsugamushi disease, an important rickettsiosis in Japan, was found there soon afterwards (4). Through October 1996, 31 clinical cases of JSF and 11 cases of Tsutsugamushi disease were diagnosed at Mahara Hospital, Tokushima Prefecture. During the same period, 45 cases of human tick bites were recorded in this JSF-endemic area in the same hospital. This article describes JSF's history, clinical characteristics, and differences from Tsutsugamushi disease and summarizes current information about the epidemiology, vectors, and causative agent of JSF. History In the 1980s, clinicians believed that Tsutsugamushi disease (scrub typhus) was the only rickettsial disease in Japan except for sporadic outbreaks of epidemic typhus in the 1950s. In Tokushima Prefecture, neither disease has been reported in the last two decades. In May 1984, a 63-year-old woman (the wife of a farmer) was hospitalized at Mahara Hospital with high fever and erythematous nonpruritic skin eruptions over the entire body. Antibiotics (ß-lactam and aminoglycoside) used for common febrile infections were not effective, but the patient gradually became afebrile in 2 weeks without effective treatment. In May and July 1984, two additional patients with similar symptoms were treated at the same hospital. Doxycycline was markedly effective in these cases. Before the onset of illness, the patients had collected shoots from bamboo plantations on the same mountain. In two of the patients, an eschar was observed. Tsutsugamushi disease was suspected. However, results of Weil-Felix tests showed positive OX2 serum agglutinins, and OXK were negative in all three cases. These results did not indicate Tsutsugamushi disease, but rather OX2-positive infections, i.e., SFG rickettsioses (1). The cases were subsequently confirmed by complement fixation test with antigens of SFG rickettsiae (5,6). The name Japanese spotted fever was proposed for these infections (7) and has been commonly used since then (8-10). Oriental spotted fever (11) is a synonym for JSF. The causative agent was isolated in 1986 (12) and named R. japonica (3). Clinical Features The clinical features of the 31 patients whose illness was diagnosed as JSF at Mahara Hospital from 1984 to October 1996 were analyzed. The disease developed abruptly, with the common symptoms of headache (25 [80%] of 31 patients), fever (31 [100%] of patients), and shaking chills (27 [87%]). Other major objective symptoms of JSF included skin eruptions (31 [100%]) and tick bite eschars (28 [90%]). Most patients (28 [90%]) complained of malaise; joint and muscle pain or numbness of the extremities was rarely mentioned. In the acute stage, remittent fever accompanied by shaking chills was frequently observed. In severe cases, high fever (40°C or more) continued for several days (Figure 1). The maximum body temperature was 38.5°C to 40.8°C (mean 39.5°C), which was higher than that seen in patients with Tsutsugamushi disease (38.5°C ~ 39.1°C). With abrupt high fever or, a few days after onset, fever of unknown origin, the characteristic erythemas developed on the extremities and spread rapidly (in a few hours) to all parts of the body including palms and soles, without accompanying pain or itching. These eruptions were the size of a grain of rice or soybean, and the margin of each of the spots was unclear (Figure 2). The erythemas became remarkable during the febrile period and tended to spread more over the extremities than the trunk. Palmar erythema, a characteristic finding not seen in Tsutsugamushi disease, disappeared in the early stage of the disease. The erythemas became petechial after 3 to 4 days, peaked in a week or 10 days, and disappeared in 2 weeks. However, in severe petechial cases, the brown pigmentation remained for 2 months or more. Eschar was observed on the hands, feet, neck, trunk, and shoulders of patients (Figure 3). This eschar generally remained for 1 to 2 weeks, but in some cases it disappeared in a few days. Eschars in JSF patients are smaller than those seen in patients with Tsutsugamushi disease and may be missed without careful observation. Regional or generalized lymphadenopathy, which is observed in almost all cases of Tsutsugamushi disease, was not remarkable in JSF patients. Swelling of the liver and spleen was observed in a few patients. One patient had cardiomegaly (5), and in another area, a patient had central nervous system involvement (13). [Figure 1] [Figures not available in ASCII version] Figure 1. Fever and clinical course, 62-year-old woman. [Figure 2] [Figures not available in ASCII version] Figure 2. Skin eruptions, hospital day 3. [Figure 3] [Figures not available in ASCII version] Figure 3. Small and shallow eschar on admission, which disappeared in a few days. Laboratory Examinations The results of laboratory examinations of JSF patients are almost the same as those of patients with common SFG rickettsioses. During clinical examinations at the initial stage of the disease, urinalyses registered a slight positive reading for protein and occult blood, which may lead to a misdiagnosis of urinary infection. In the acute stage, leukocytosis may also be found with leukopenia (3,600~12,800), and a left shift in leukocyte count was observed. Thrombocytopenia (6.8~35.3) may also be found. In week 1 to 2, leukocyte counts increased slightly, and lymphocyte counts tended to increase. Among biochemical examinations, C-reactive proteins were strongly positive, and liver functions were slightly impaired but returned to normal in 2 to 3 weeks. Serologic Results Serodiagnosis for JSF is usually performed by the indirect immunoperoxidase (IP) or immunofluorescence (IF) techniques, with antigens prepared from R. japonica or other SFG rickettsiae. With the IP test, IgG and IgM antibodies were detected in the sera beginning on day 9 after the onset of fever; titers of IgG antibodies were higher than those of IgM antibodies (14). The IF test had similar results (15). In the 31 clinically diagnosed cases of JSF in Tokushima Prefecture at Mahara Hospital, all patients had significant changes in serum IP antibody titers to R. japonica, and 27 (87%) had significant changes in OX2 agglutinin titers by the Weil-Felix technique (10,14; F. Mahara, unpub. data). Treatment Antibiotics such as penicillins, ß-lactams, or aminoglycosides, commonly used in the empiric treatment of febrile disease, were completely ineffective, but doxycycline and minocycline were markedly effective in treating the JSF patients (16). On the first day of hospitalization in one patient with severe disease (Figure 1), fever of more than 40°C with shaking chills persisted after the antibiotics cefazolin and fosfomycin were administered. The general condition of the patient worsened and on the morning of the third day, generalized edema and confusion developed. On day 3, the patient was given drip infusion of doxycycline 300 mg per day, which was dramatically effective; the fever decreased to 38°C during the first drip infusion. In an in vitro study, minocycline was the most effective antibiotic against R. japonica, followed by other tetracycline antibiotics (17,18). In contrast, the sensitivity to ß-lactam and penicillin was lower or negligible, but quinolones were effective against the JSF agent (18). Three patients were treated with a new quinolone (tosufloxacin 300 mg per day in three divided doses per os), which proved effective in two cases (9). Patients with dehydration received drip infusion of doxycycline or minocycline (200 mg to 300 mg per day for 3 to 7 days), and after becoming afebrile, received 200 mg per day 2 divided doses to prevent relapse. Patients suspected of having JSF should receive empiric therapy with minocycline or doxycycline without waiting for serologic confirmation of illness. Epidemiology From 1984 to 1995, 144 cases of JSF were reported by the National Institutes of Health in Japan (19; Figure 4). Case reports included only the number of cases and prefectures where cases were reported, including Tokushima Prefecture. According to this information, JSF-endemic prefectures are located along the coast of southwestern and central Japan in a warm climate (Figure 5). The landscape is diverse, including bamboo plantations, crop fields, coastal hills, and forests (20). Of the 31 JSF patients in Tokushima Prefecture, nine were male, and 22 were female. Ages were 4 to 78 years, but most patients (68%) were 60 to 70 years old. The onset of the disease was 2 to 8 days after work in the fields. In this prefecture, farmers work in the forest to gather bamboo shoots in the spring and chestnuts in the autumn; cases occurred from April to October (6,18; Figure 6). In this area, we can distinguish seasonal differences in the occurrence of JSF and Tsutsugamushi disease; whereas JSF occurs from spring to autumn, Tsutsugamushi disease occurs in winter (November-February). Although seasonal differences occur in the western parts of Japan, the prevalent seasons for Tsutsugamushi disease vary in other parts of Japan (21). [Figure 4] [Figures not available in ASCII version] Figure 4. The number of Japanese spotted fever patients in Japan (1984-1995). [Figure 5] [Figures not available in ASCII version] Figure 5. Geographic distributions of JSF and Tsutsugamushi disease in Japan. [Figure 6] [Figures not available in ASCII version] Figure 6. Seasonal prevalence of Japanese spotted fever and Tsutsugamushi disease. Like other SFG rickettsioses, JSF is presumed to be transmitted by a tick bite. The high proportion of patients with tick bite eschars supports this hypothesis. Thirteen JSF patients (28.9%) recalled tick bites before the onset of illness; however, the ticks had been lost, and no specimens from the patients were available for further study. From 1984 to October 1996, 45 persons with tick bites were recorded at Mahara Hospital (Table 1). Identified ticks included three genera and eight species. Table 1. Cases of human tick bites, Mahara Hospital, 1984-1996 --------------------------------------------------------------- Female Male Nymph Larva Total --------------------------------------------------------------- Haemaphysalis flava 1 4 5 Haemaphysalis longicornis 8 1 3 2 14 Amblyomma testdunarium 4 1 12 17 Ixodes ovatus 1 1 Ixodes nipponensis 4 4 Ixodes persulcatus 2 2 Ixodes tanuki 1 1 Haemaphysalis kitaokai 1 1 Totals 20 2 21 2 45 --------------------------------------------------------------- Three genera and six species of ticks have been reported as positive for R. japonica in JSF-endemic areas (Table 2). Hemolymph samples from Dermacentor taiwanensis, Haemaphysalis flava, Haemaphysalis formosensis, Haemaphysalis hystricis, Haemaphysalis longicornis, and Ixodes ovatus were positive when tested by the IP technique using a species-specific monoclonal antibody against R. japonica (22). R. japonica was also detected by IF in the hemolymph of H. longicornis (23). A polymerase chain reaction (PCR) technique using species-specific primers detected R. japonica in H. hystricis (24), H. flava, and I. ovatus (25). The agent has also been detected in H. longicornis by restriction fragment length polymorphism of PCR product (23). Of these, H. flava, H. longicornis, and I. ovatus commonly feed on humans in Japan (26). Recent tick surveys in Japan have identified two serotypes or species of SFG rickettsial isolates other than R. japonica, which are of uncertain clinical significance (27,28). Table 2. Reported tick species positive for Rickettsia japonica and their prevalence in endemic disease areas -------------------------------------------------------------------------- No. positive/no. examined ------------------------------------------------ Tick species Tokushima Kochi Kanagawa -------------------------------------------------------------------------- Dermacentor taiwanensis 3/5(a), 1/1(b) - - Haemaphysalis flava 6/36(a) 3/10(a) 1-3/90(c) Haemaphysalis formosensis - 10/16(a) - Haemaphysalis hystricis +(d) 5/9(a) - Haemaphysalis longicornis - 1/1(a), 6/9(e), - 5-33/33(f) Ixodes ovatus 1/13(a) - 1/16(c) --------------------------------------------------------------------------- (a)Hemolymph test by immunoperoxidase stain using R. japonica-specific monoclonal antibody (22). (b)Isolation (28). (c)Polymerase chain reaction (PCR) using the primers designed for amplifying the genomic DNA from only R. japonica (25). (d)PCR method same as the above (24). Number was not shown. (e)Hemolymph test by immunoflurescein stain using R. japonica-specific monoclonal antibody (23). (f)Restriction fragment length polymorphism of PCR product (23). Pathogen The etiologic agent was first isolated from a patient (in Kochi Prefecture) in 1986 (12). In 1987, the causative rickettsia was also isolated from a JSF patient in Tokushima Prefecture (29-31). The former isolate is the type strain YH (ATCC VR-1363), later named R. japonica, a new SFG rickettsia; the latter strain (Katayama) was the first isolate from JSF-endemic areas outside Kochi (3,32). The Katayama strain type and R. japonica were demonstrated by serologic analysis using monoclonal antibodies (33). Serotyping by use of the reciprocal crossreactions of mouse antisera to six human isolates from Tokushima and the type strain YH or R. japonica also indicated that these are the same species (34). In 1988, another strain was isolated from a patient in Awaji Island, Hyogo Prefecture, which is considered a new area of JSF-endemic disease (35). Recently, an isolate from a febrile patient in Wakayama Prefecture was also reported as R. japonica (36). In an electron microscopy study, R. japonica were generally recognized as short rods or pleomorphic coccobacillary forms less than 2 mm in length and 0.5 mm in diameter and could be found not only in the cytoplasms but also in the nuclei of the host cells (37). A multilayered mesosome-like structure was observed in the rickettsiae multiplying in a host cell (38). This unique structure has not been reported in other species except in Rickettsia prowazekii (39). After the initial isolation, at least 20 rickettsial strains have been isolated from JSF patients by cell culture techniques or nude mouse passage in Tokushima, Kochi, Hyogo, Chiba, and Wakayama Prefectures. However, it has not been determined if their strains differ in virulence. Ten diseases caused by SFG rickettsiae have been reported in humans (40): Rocky Mountain spotted fever, Mediterranean spotted fever, Siberian tick typhus, African tick bite fever, Queensland tick typhus, Japanese spotted fever, Israeli spotted fever, Astrakhan spotted fever, Flinders Island spotted fever, and rickettsialpox. The clinical symptoms of JSF—a triad of high fever, skin eruptions, and tick bite eschar—are similar to those of typical SFG rickettsioses. With regard to skin eruptions, eschar, and severity of the disease, JSF is more akin to Mediterranean spotted fever and Siberian tick typhus than to Rocky Mountain spotted fever. Recent tick surveys indicated that the most probable vectors of JSF are H. flava, H. longicornis, and I. ovatus. In Japan, the clinical features of JSF are similar to those of Tsutsugamushi disease; however, close clinical observation exposes the differences between the two diseases. Widespread outbreaks of Tsutsugamushi disease have been reported repeatedly in recent years (21). No fatal cases of JSF have been reported. However, death rates from other SFG rickettsioses (approximately 2.5% for Mediterranean spotted fever [41] and 3% to 7% from Rocky Mountain spotted fever [42]) suggest that unless JSF is treated appropriately, it can pose the same risk. If JSF is suspected, empiric treatment should begin without delay during the early stages of disease. Acknowledgments The author thanks Professor Emeritus Suto T., Department of Microbiology, Akita University, for serologic confirmation; Professor Jan Kazar, Slovak Academy of Sciences, for his helpful advice; Drs. Fujita H., Ohara Research Laboratory and Takada N., Fukui Medical School, for epidemiologic studies; and all colleagues who collaborated in the investigations. Dr. Mahara is chief director of Mahara Hospital, Tokushima, Japan. He serves as a counselor of the Japanese Association for Infectious Diseases and is a member of the International Eurasian Academy of Sciences. References 1. Brouqui P, Raoult D. Clinical aspect of human SFG rickettsiae infection in the era of molecular biology. In: Kazar J, Toman R, editors. Proceedings of the 5th International Symposium on Rickettsiae and Rickettsial Diseases. Bratislava, Slovak: Slovak Academy of Science, 1996;195-210. 2. Mahara F. Three Weil-Felix reaction (OX2) positive cases with skin eruptions and high fever. Journal of Anan Medical Association 1984;68:4-7. 3. Uchida T, Uchiyama T, Kumano K, Walker DH. Rickettsia japonica sp. nov., the etiological agent of spotted fever group rickettsiosis in Japan. Int J Syst Bacteriol 1992;42:303-5. 4. Mahara F, Fujita H, Suto T. 11 cases of Japanese Spotted Fever and first report of the Tsutsugamushi disease in Tokushima Prefecture. J Jpn Assoc Infect Dis 1989;63:963-4. 5. Mahara F, Koga K, Sawada S, Taniguchi T, Shigemi F, Suto T, et al. The first report of the rickettsial infections of spotted fever group in Japan; three clinical cases. J Jpn Assoc Infect Dis 1985;59:1165-72. 6. Mahara F. Clinical pictures of the spotted fever group rickettsiosis. J Jpn Assoc Clin Virol 1985;13:447-52. 7. Mahara F. Japanese spotted fever: a new disease named for spotted fever group rickettsiosis in Japan. Annu Rep Ohara Hosp 1987;30:83-91. 8. Emilio Weiss. Rickettsias. Joshua Lederberg, editor. Encyclopedia of Microbiology, Academic Press, Harcourt Brace Jovanovich, New York, 1992; Vol.3:585-610. 9. Mahara, F. Japanese Spotted Fever. Oka H, Wada T, editors. Encyclopedia of Medical Science, Kodansya, Tokyo, 1992; suppl.9:27-30. 10. Mahara F. Japanese Spotted Fever, clinical features and vectors. Kazar J, Toman R, editors. Proceedings of the Vth International Symposium on Rickettsiae and Rickettsial Diseases. Publishing House of the Slovak Academy of Science, Bratislava, Slovak, 1996;641-6. 11. Uchida T. Rickettsia japonica, the etiologic agent of oriental spotted fever. Microbiol Immunol 1993;37:91-102. 12. Uchida T, Tashiro F, Funato T, Kitamura Y. Isolation of a spotted fever group rickettsia from a patient with febrile exanthematous illness in Shikoku, Japan. Microbiol Immunol 1986;30:1323-6. 13. Iwamoto K, Nishimura F, Yoshino Y, Mihara J, Okabe T, Kameda H, et al. A case of spotted fever with central nervous system involvement. J Jpn Assoc Infect Dis 1988;62:1192-6. 14. Amano K, Hatakeyama H, Okuta M, Suto T, Mahara F. Serological studies of antigenic similarity between Japanese spotted fever rickettsiae and Weil-Felix test antigens. J Clin Microbiol 1992;30:2441-6. 15. Uchida T, Tashiro F, Funato T, Kitamura Y. Immunofluorescence test with Rickettsia montana for serologic diagnosis of rickettsial infection of the spotted fever group in Shikoku, Japan. Microbiol Immunol 1986;30:1061-6. 16. Mahara F. Clinical findings of Japanese Spotted Fever and Tsutsugamushi disease. Acari-Disease Interface, (ed.) Organizing Committee of SADI , Yuki Press Inc., Fukui, 1994;38-45. 17. Suto T, Hatakeyama H, Ito R, Nakamura Y. In vitro susceptibility of a strain of rickettsia recently isolated from a case of Japanese spotted fever to chemotherapeutic agents. J Jpn Assoc Infect Dis 1989;63:35-8. 18. Miyamura S, Oota T. In vitro susceptibility of rickettsial strains from patients with Japanese Spotted Fever to quinolones, penicillins and other selected chemotherapeutic agents. Chemotherapy 1991;39:258-60. 19. Tsuboi Y. The laboratory examination method for rickettsioses. Clin Virol 1995;23;394-9. 20. Takada N. Review: recent findings on vector acari for rickettsia and spirochete in Japan. Jpn J Sanit Zool 1995;46:91-108. 21. Suto T. Tsutsugamushi disease now. Med J Akita City Hosp 1995;4:1-18. 22. Takada N, Fujita H, Yano Y, Oikawa Y, Mahara F. Vectors of Japanese spotted fever. J Jpn Assoc Infect Dis 1992;66:1218-25. 23. Uchida T, Yan Y, Kitaoka S. Detection of Rickettsia japonica in Haemaphysalis longicornis ticks by restriction fragment length polymorphism of PCR product. J Clin Microbiol 1995;33:824-8. 24. Furuya Y, Katayama T, Yoshida Y, Kaiho I, Fujita H. Analysis of Rickettsia japonica DNA and detection of the DNA by PCR. Acari-Disease Interface (ed.) Organizing Committee of SADI, Yuki Press Inc., Fukui, 1994;141. 25. Katayama T, Furuya Y, Yoshida Y, Kaiho I. Spotted fever group rickettsiosis and vectors in Kanagawa Prefecture. J Jpn Assoc Infect Dis 1996;70:561-8. 26. Yamaguti N. Human tick bites in Japan. Acari-Disease Interface (ed.) Organizing Committee of SADI, Fukui: Yuki Press Inc., 1994;16-23. 27. Fujita H, Watanabe Y, Takada N, Yano Y, Tsuboi Y, Mahara F. Spotted fever group rickettsiae isolated from ticks in Japan. Acari-Disease Interface (ed.) Organizing Committee of SADI, Fukui: Yuki Press Inc., 1994;142-9. 28. Takada N, Fujita H, Yano Y, Tsuboi Y, Mahara F. First isolation of a rickettsia closely related to Japanese spotted fever pathogen from a tick in Japan. J Med Entomol 1994;31:183-5. 29. Fujita H, Watanabe Y, Mahara F. Isolation of a causative rickettsia from a patient with Japanese spotted fever in Tokushima Prefecture, Japan. Annu Rep Ohara Hosp 1988;31:17-21. 30. Kobayashi Y, Tange Y, Kanemitsu N, Okada T, Mahara F. The causative agent from a patient with spotted fever group rickettsiosis in Tokushima Japan. J Jpn Assoc Infect Dis 1988;62:1132-7. 31. Hatakeyama H, Ito R, Nakamura Y, Suto T, Amano K, Mahara F. Characterization of spotted fever group rickettsiae isolated from Japanese spotted fever patients. Clinical Microbiology 1991;18:103-8. 32. Uchida T, Yu X, Uchiyama T, Walker DH. Identification of a unique spotted fever group rickettsia from humans in Japan. J Infect Dis 1989;159:1122-6. 33. Oikawa Y, Takada N, Fujita H, Yano Y, Tsuboi Y, Ikeda T. Identity of pathogenic strains of spotted fever rickettsiae in Shikoku district based on reactivities to monoclonal antibodies. Jpn J Med Sci Biol 1993;46:45-9. 34. Fujita H, Watanabe Y, Takada N, Tsuboi Y, Mahara F. Isolation and serological identification of causative rickettsiae from Japanese spotted fever patients. Asian Med J 1993;36:660-5. 35. Kobayashi Y, Tange Y, Okada T, Kodama K. The causative agent from a patient with spotted fever group rickettsiosis in Japan on Awaji Island, Hyogo. J Jpn Assoc Infect Dis 1990;64:413-8. 36. Fujita H. Isolation of Rickettsia japonica from a febrile patient-Wakayama. Infectious Agents Surveillance Report 1995;16:30. 37. Iwamasa K, Okada T, Tange Y, Kobayashi Y. Ultra-structural study of the response of cells infected in vitro with causative agent of spotted fever group rickettsiosis in Japan. APMIS 1992;100:535-42. 38. Amano K, Hatakeyama H, Sasaki Y, Ito R, Tamura A, Suto T. Electron microscopic studies on the in vitro proliferation of spotted fever group rickettsia isolated in Japan. Microbiol Immunol 1991;35:623-9. 39. Silverman DJ, Wisseman CL, Jr. Comparative ultra-structural study on the cell envelopes of Rickettsia prowazekii, Rickettsia rickettsii, and Rickettsia tsutsugamushi. Infect Immun 1978;21:1020-3. 40. Beati L, Raoult D. Spotted Fever Rickettsiae. Kazar J, Toman R, editors. Proceedings of the Vth International Symposium on Rickettsiae and Rickettsial Diseases. Publishing House of the Slovak Academy of Science, Bratislava, Slovak 1996;134-69. 41. Raoult D, Weiller PJ, Chagnon A, Chaudet H, Gallais H, Casanova P. Mediterranean spotted fever. Am J Trop Med Hyg 1986;35:845-50. 42. Hattwick MAW, O'Brien RJ, Hanson B. Rocky mountain spotted fever: epidemiology of increasing problem. Ann Int Med 1986;84:732-9. --------------------------------------------------------------------------- [Emerging Infectious Diseases * Volume 3 * Number 2 * April-June 1997] Synopses Polycystic Kidney Disease: An Unrecognized Emerging Infectious Disease? Marcia A. Miller-Hjelle,* J. Thomas Hjelle,* Monica Jones,* William R. Mayberry,† Mary Ann Dombrink-Kurtzman,‡ Stephen W. Peterson,‡ Deborah M. Nowak,* and Frank S. Darras* *University of Illinois College of Medicine at Peoria, Peoria, Illinois, USA; †East Tennessee State University, Johnson City, Tennessee, USA; and ‡U.S. Department of Agriculture, Agricultural Research Service, Peoria, Illinois, USA --------------------------------------------------------------------------- Polycystic kidney disease (PKD) is one of the most common genetic diseases in humans. We contend that it may be an emerging infectious disease and/or microbial toxicosis in a vulnerable human subpopulation. Use of a differential activation protocol for the Limulus amebocyte lysate (LAL) assay showed bacterial endotoxin and fungal (1[-]3)-ß-D-glucans in cyst fluids from human kidneys with PKD. Fatty acid analysis of cyst fluid confirmed the presence of 3-hydroxy fatty acids characteristic of endotoxin. Tissue and cyst fluid from three PKD patients were examined for fungal components. Serologic tests showed Fusarium, Aspergillus, and Candida antigens. IgE, but not IgG, reactive with Fusarium and Candida were also detected in cyst fluid. Fungal DNA was detected in kidney tissue and cyst fluid from these three PKD patients, but not in healthy human kidney tissue. We examine the intertwined nature of the actions of endotoxin and fungal components, sphingolipid biology in PKD, the structure of PKD gene products, infections, and integrity of gut function to establish a mechanistic hypothesis for microbial provocation of human cystic disease. Proof of this hypothesis will require identification of the microbes and microbial components involved and multifaceted studies of PKD cell biology. Examining the hypothesis that polycystic kidney disease (PKD) is an emerging infectious disease and/or microbial toxicosis in a vulnerable population of humans must begin with a review of the conceptual tools that relate disease etiology and progression to the identification of microbes, their cellular components, and shed toxins in affected persons (1). An emerging infectious disease can be defined, in part, as an existing disease for which microbes are newly recognized as a causative factor and/or as a factor contributing to disease progression. The microbe may be 1) present at the site of a lesion, 2) disseminated throughout the body, or 3) localized to an anatomic site separate from the primary lesions. In this third case, one or more toxins released by the microbe into distribution fluids, usually blood, produce the pathologic effect(s); this process resembles microbial toxicosis, where the patient is exposed only to the toxin(s) present in the diet, environment, and gut microflora. Distinguishing between an infectious disease and microbial toxicosis is essential if the source of the toxin is to be removed or reduced. Concurrent infection and microbial toxicosis (e.g., endotoxicosis, mycotoxicosis) can also occur. Although mycotoxicosis is commonly understood to refer to the absorption of small organic fungal toxins, such as aflatoxin, fumonisin, or trichothecene, detection of toxin in body fluids and tissues is often difficult. Exposure to toxin may be episodic. For many known and newly discovered microbial toxins, analytical methods pertinent to the levels of toxins involved in acute and chronic disease, especially in vulnerable subpopulations, need to be developed and verified in human tissues and fluid. We have taken the view that the presence of signature components of microbial genera/species that produce toxins may indicate that all components of the microbe, including its shed toxins, are also present. As a corollary, absorption of the detectable microbial components, which are often larger in molecular size than the classical mycotoxins and endotoxins, should presume the absorption of other components and toxins from this organism. On its face, PKD would not appear to be an emerging infectious disease. Classically viewed as an inherited disease that follows Mendelian genetics, PKD in its autosomal dominant form affects 600,000 people in the United States at a rate of 1 in 400-1,000 persons; the autosomal recessive form occurs in 1 per 44,000 births. An acquired form of PKD occurs in patients on renal dialysis. Animal models of inherited and chemically induced PKD have been described (2-4). The current consensus is that fundamental anomalies in cell differentiation or maturation explain the array of anomalies in cystic renal epithelium. Although cysts can sometimes be detected in utero, loss of kidney function to the point of endstage renal disease occurs by the sixth decade in 50% of autosomal-dominant PKD patients. Despite substantial progress in molecular genetics studies of PKD, the role of defective gene products in its causation and progression to end-stage renal disease has remained elusive (3,5,6). Indeed, additional factors have been proposed as being necessary for progression of PKD to end-stage renal disease. PKD patients have higher rates of renal and urinary tract infections and higher rates of illness and death from infection in general than healthy persons (7,8). Since these infections in otherwise-healthy-persons do not lead to PKD, PKD patients could be exhibiting heightened vulnerability to infection and sensitivity to microbial cell components and toxins. How such sensitivity and vulnerability might occur is unknown. The disease does not appear to involve an immunocompromised state. Thus, alternative possibilities need to be considered, such as altered colonization of the uroepithelium and altered bowel structure and colonization. Microbes and Microbial Components Werder et al. (9) performed perhaps the critical experiment in establishing a pathogenic role for microbes in PKD. Using genetically cystic mice, they found that mice grown under germ-free conditions survived substantially longer than cystic littermates grown under ambient conditions. Gardner et al. (10,11) extended these observations when they reported that rats fed a chemical cystogen also had lower rates of renal cystogenesis when raised under germ-free conditions; moreover, coadministering the ubiquitous cell wall component of gram-negative bacteria, lipopolysaccharides (LPS), and the chemical cystogen produced higher rates of cyst formation than using cystogen alone. Thus, LPS was considered a provocateur of the underlying genetic (or chemically induced) susceptibility to renal cystogenesis. From this line of research has emerged the possibility that LPS, either alone or in combination with other microbial or environmental factors, promote disease progression, and removal of such provocateurs would slow the progression of PKD to end-state renal disease. Endotoxin is the mixture of LPS and other bacterial cell wall proteins and constituents that is found in bacterial infections (12). LPS is isolated by solvent extraction of bacterial cell walls; its chemical purity may vary across preparations. The portion of LPS responsible for most of its known biological activities is Lipid A; the carbohydrate side chains also elicit responses in humans (13). The chemical composition of LPS depends on the genera and species of bacteria from which it is isolated (13,14). As knowledge of the structure and biological activities of LPS has increased and merged with the infectious disease vocabulary based on endotoxin, these terms are sometimes used interchangeably. For example, the highly purified LPS used as positive reference material in the Limulus amebocyte lysate (LAL) assay is called Control Standard Endotoxin. Even though interchanging the terms LPS and endotoxin may promote appreciation of microbial involvement in disease, we prefer the term endotoxin in discussing disease because it respects the structural and pharmacologic heterogeneity of LPS and mixtures of other microbial components present in vivo. When Miller et al. (15) measured putative endotoxin levels by the classic LAL assay in culture-negative urine samples of male PKD patients with no clinically apparent infection, 80% contained detectable LAL-positive material, while the urine samples of healthy male volunteers did not. In cyst fluid from PKD patients, Gardner et al. (16) reported LAL-positive material and cytokines typically induced by LPS. The origins of the renal and urinary endotoxin were not known; possible sources include the gut microflora, occult urogenital infections, cryptic colonizations, and abnormal handling by the liver of the normal daily load of absorbed endotoxin. Enhanced exposure to endotoxin in the PKD patient is important since endotoxin plays a fundamental role in human health and disease. In low doses, endotoxin enhances the immune system, but in larger amounts it is lethal. In combination with drugs and other substances, it can cause tissue damage and severe disease; examples of endotoxin synergy with other substances resulting in disease include alcohol in cirrhosis, aspirin in Reyes syndrome, and trichothecene T-2 toxin (a mycotoxin from Fusarium) in gastrointestinal tract damage (17). Endotoxin can also promote the translocation of bacteria from the gut into the blood (18). In susceptible persons, chronic exposure to endotoxin has been linked to rheumatoid arthritis (19); tentative links with atherosclerosis have also been reported (20). Although suggestive of endotoxin in PKD, the LAL methods used above were not specific for endotoxin, since they were susceptible to false positive and/or negative results. Bacterial Endotoxin in Human PKD Renal Cysts In this report, we describe our recent findings concerning 1) endotoxin levels recorded after recent improvements in LAL methods, 2) analysis of fatty acids specific for bacterial endotoxin, and 3) the presence of other microbial components in human cyst fluid. The LAL assay (Figure 1) is the classic method used to detect the low levels of endotoxin in biologic fluids and pharmaceuticals. Both endotoxin (in eight of eight patients) and (1[-]3)-ß-D-glucans (in two of eight patients) were detected when methods based on differential activation of the two Limulus pathways were applied to cyst fluids from six autosomal-dominant PKD patients, one autosomal-recessive PKD patient, and a patient with simple cysts, where 200 ml from a single simple cyst were recovered (Table 1). None of these patients exhibited clinical evidence of infection, had been on hemodialysis, or received human immunologic products before nephrectomy, which could have accounted for ß-D-glucan reactivity (26). For six patients (four autosomal dominant, one autosomal recessive, and one with simple cysts), only endotoxin was detected in cyst fluids; gel clot end points for both the LAL and LAL+laminarin assays were equal for each fluid tested, indicating that the ß-D-glucan stimulated pathway was not activated. When exposed to polymyxin B, LAL-positive cyst fluids became negative. This is consistent with the conformational changes that occur when this antibiotic binds to Lipid A to form a stoichiometric complex that is inactive in the assay (25). In contrast, kidney tissue from one male patient (donor 4) and one female patient (donor 5) yielded cyst fluids that contained separately endotoxin or ß-D-glucan; however, no single fluid contained both substances (Table 1). Fluids that were LAL positive in the presence or absence of polymyxin B, but negative in the presence of laminarin are consistent with the detection of ß-D-glucan. Donor 6 had been on peritoneal dialysis for slightly more than 1 year before nephrectomy. Although cyst fluids were all initially LAL negative, when the incubation time of the LAL assay was increased from 1 to 2 hours, 4 of 13 cyst fluids were endotoxin positive, albeit at much lower concentrations than the fluids from patients not on dialysis. None of the cyst fluids from donor 6 were positive for ß-D-glucan after longer incubations. Longer incubation times might also have produced LAL-positive material in LAL-negative cyst fluids from the other donors; therefore, we view the percentage of LAL-positive cyst fluids for each patient as a minimum value. [Figure 1] [Figures not available in ASCII version] Figure 1. Cascade of biochemical interactions and reactions leading to gel clot formation in the Limulus amebocyte lysate assay. Endotoxin binding to Factor C via the Lipid A moiety results in its activation and in turn the sequential activation of Factor B, which results in the subsequent activation of the proclotting enzyme. Binding of polymyxin B to endotoxin blocks Limulus reactivity in those samples where endotoxin is the initiating molecule. In contrast, (1[-]3)-ß-D-glucans bind to a different component, Factor G, in the Limulus assay reagent, thereby leading to its activation and subsequent cascade of reactions to gel formation. The addition of laminarin, an inhibitor of glucan binding to Factor G, to Limulus assay reagent blocks reactivity of samples containing glucan (21). Lipid A binds to and activates Factor C resulting in a cascade of enzymatic reactions leading to gel clot formation, the positive endpoint (22). Also present in the classic LAL reagents is Factor G, which is responsible for a side cascade (i.e., the alternative pathway). Factor G is stimulated by (1 [-]3)-ß-D-glucans, associated primarily with fungal cell walls (23). Addition of laminarin, an inhibitor of glucan binding to Factor G (24), permits a more specific measurement of endotoxin-induced gel clot formation and provides a means of screening for (1[-]3)-ß-D-glucans in biological samples, when used in a differential activation protocol with other inhibitors and activators. As two internal controls, polymyxin B can block the LAL reactivity of endotoxin (25), and known quantities of Control Standard Endotoxin can be added to duplicate samples to detect inhibition of the assay. Table 1. Limulus assay results from human kidney cyst fluids --------------------------------------------------------------- Cysts ET positive (%): Cysts ß-D-glucan Donor Patient No. Cysts Endotoxin positive (%): No. data Tested units/ml(a) pg/ml --------------------------------------------------------------- 1 AD(b) 45 yr5 3 (60%): 0.48 nd(c) F EU/ml 2 AD 52 yr F 6 4 (67%): 1.71 nd EU/ml 3 AD 48 yr M L(d) 9 5 (56%): 1.45 nd EU/ml R(e) 11 6 (55%): 2.27 nd EU/ml 4 AD 41 yr F 16 3 (19%): 0.88 3 (19%): 120 EU/ml pg/ml 5 AD 37 yr M 11 2 (18%): 3.84 6 (55%): 106 EU/ml pg/ml 6 PD(f) AD 4313 4 (31%): 0.26 nd yr F EU/ml 7 AR(g) 5 wk pool(8) 3.84 EU/ml nd M 8 SC(h) 48 yr1(200ml) 3.84 EU/ml nd F --------------------------------------------------------------- (a)Mean EU/ml or pg (1[-]3)ßD-glucan/ml (b)Autosomal-dominantpolycystic kidney disease (PKD) (c)Not detected (d)Left kidney (e)Right kidney (f)Peritoneal dialysis (g)Autosomal recessive PKD (h)Simple kidney cyst (not PKD) Kidneys were from seven patients who had received or were awaiting renal allografts. Cyst fluid was obtained ex vivo from both surface (cortex) and sub-surface (medullary) cysts by aseptic aspiration from seven excised kidneys (post-nephrectomy) of PKD patients; simple cyst fluid was recovered by radiologically guided needle aspiration. All kidneys and cyst fluids were collected under an approved Institutional Review Board protocol. The mean number of cysts aspirated per kidney was 10 (range 1-21); two kidneys were obtained from one of the patients with both being used for studies. Fluid from individual cysts in each kidney were collected separately, except for the autosomalrecessive PKD patient in whom cyst volumes were too small (~ 0.1 ml) for individual testing. Therefore, fluid from eight cysts in close proximity were pooled. All procedures used pyrogen-free materials in the collection, handling, and processing of kidneys and cyst fluids and preparation of commodities and reagents for the Limulus assay. Depyrogenation was carried out at 250°C for 4 hours, which eliminates both endotoxin and (1[-]3)-ß-D glucans (27). Cyst fluids were stored at -70°C. Assessment parameters of cysts included color and size; for fluids, color, turbidity, pH, mg protein/ml, specific gravity, and blood. A commercial dipstick was used to detect and semiquantitate cyst fluid pH, specific gravity, and blood (Ames 10 SG Multistix, Miles, Inc., Elkhart, IN, USA). Blood sensitivity was 0.015-0.062 mg/dL hemoglobin, equivalent to 5-20 intact red blood cells per microliter. Results were recorded as 1-4+. For specific gravity, determinations permitted ranged from 1.000-1.030; for pH, 5.0-9.0. Protein was by the method of Lowry et al. (28). The LAL gel clot end point assay (22) was performed according to the manufacturer's instructions (Charles River ENDOSAFE, Charleston, SC). The mechanism of the LAL assay is illustrated in Figure 1. To quantify endotoxin, undiluted samples and serial twofold dilutions through 1:64 were tested. To detect false positives due to activation of the alternate (1[-]3)-ß-DG pathway, LAL assay reagent fortified with the glucan inhibitor laminarin was used (23). Laminarin was courtesy of Dr. J. Cooper, Charles River ENDOSAFE, Charleston, SC. Laminarin had been rendered endotoxin free by treatment with 0.2 N NaOH at 50°-60°C for 6 hours; treatment did not affect activity of laminarin in the LAL assay (23). The standard gel clot end point method was used, except laminarin was added to the LAL assay reagent (23). Minimum sensitivity of both assays was 0.03-0.06 Endotoxin Units (EU)/ml (3-6 pg control standard endotoxin, CSE; 10 EU/ng of EC-5 (E.coli O133) U.S. Standard endotoxin; for ß-DG, ³10 pg/ml (29). Known endotoxin-positive (tap water) and -negative (pyrogen-free water) samples were run as controls along with a CSE curve. The endotoxin concentration was estimated by multiplying the maximum dilution producing a positive test against the sensitivity of lysate that was verified daily. The content of ß-DG in cyst fluid was estimated by the difference in titers between the endotoxin specific assay (LAL+laminarin) and the conventional LAL assay (30). Portions of all samples were additionally spiked with 0.25 EU CSE and tested for inhibitory substances. If inhibition was observed in the LAL assays, samples were boiled for 5 minutes, cooled to room temperature, and retested. Samples were incubated, in some cases after boiling, for 30 min at room temperature with polymyxin B (5 mg/assay) before LAL testing. Polymyxin B inhibits the LPS-activated pathway via Factor C by its direct binding to LPS, which yields a nonreactive complex (25). An alternative approach was to use 20% dimethyl sulfoxide (DMSO) to inhibit Factor C directly (23); DMSO was not used to permit detection of nonendotoxin, but LAL-reactive materials that were not inactivated by binding to polymyxin B. However, in our system DMSO did completely block the LAL reaction in the presence of CSE. After centrifugation of the cyst fluid, the LAL-positive material was located only in the supernate for autosomal-recessive- and simple cyst-derived fluids. For autosomal dominant-derived fluids, the reactive material was located in the pellet. Thus, centrifugation of fluids to remove particulate material before the LAL assay may influence results. LAL assay inhibition was detected in nearly two-thirds of 73 cyst fluids tested, including autosomal recessive and simple cyst fluids. Dilution of cyst fluid through 1:16 was often required to overcome the inhibitory effect in unboiled specimens. Boiling of entire fluids or supernates and pellets for 5 minutes eliminated LAL assay inhibition in virtually all specimens at all dilutions. Exceptions were some undiluted and 1:2 dilutions of chocolate-colored cyst fluids, where inhibition was not eliminated in both test and spiked specimens of autosomal dominant fluids. The concentrations of endotoxin-specific material in autosomal dominant cyst fluids was 0.12 to 3.84 EU/ml, with substantial levels of endotoxin (3.84 EU/ml) also found in a pool of eight cysts from one autosomal recessive kidney and simple cyst fluid from one donor. The mean concentration of endotoxin across all of the auto-somal dominant fluids tested (including those that were LAL negative) was 0.65 EU/ml. Using 10 EU/ng as a conversion factor yields 65 pg endotoxin/ml cyst fluid; normal plasma levels of endotoxin are <4-5 pg/ml (31). Intravenous injection of 5 EU/kg body weight (350 EU/70 kg) can induce shock in the average adult male (21). We estimate that a single cystic kidney in an adult male (3-5 kg kidney weight of which 33% is cyst fluid) contains 648 to 1,080 EU/kidney or about two lethal doses of endotoxin per kidney. Unexplained fever and flank pain in PKD patients have been attributed to release of IL-1 from rupture or hemorrhage of cysts (27). On the bases of the high levels of endotoxin observed in this study and the high sensitivity of humans to endotoxin, we propose that the release of endotoxin from the cyst into the peritoneum or blood may be an important initiator of a cascade of biologic events after leakage or rupture of renal cysts. For one donor (donor 3) both kidneys were available for cyst fluid analysis (nine left and 11 right kidney cysts, respectively). When the frequency of LAL-positive fluids (endotoxin) was compared, no significant difference was found (Table 1). However, a threefold difference in the frequency of inhibitor detection was observed in left kidney cyst fluids compared with the right kidney (90% vs. 31%, respectively). Thus, LAL testing of fluids for endotoxin requires vigilance for both false negative and positive materials. Signature Bacterial Fatty Acids If endotoxin is present in renal cysts, fatty acids unique to endotoxin can be used to confirm its presence. The Lipid A region of LPS contains on average four 3-hydroxy (3-OH) acyl groups of various chain lengths (13,14). Acid hydrolysis of LPS releases the 3-OH fatty acids and other fatty acids. Diverse bacterial genera exhibit characteristic ratios of fatty acids of various chain lengths and patterns of hydroxylation; compilations of such signature fatty acid profiles are available for many genera (14). Initially, aliquots of five cyst fluids were analyzed in a single blind manner by gas chromatography-mass spectrometry as described by Mayberry and Lane (32). 3-Hydroxy (3-OH) fatty acids of nC:12:0 and nC:14:0 carbon length were detected but not quantified in the three cyst fluids that were positive in the endotoxin specific LAL assay; they were not detected in the two cyst fluids that were LAL negative. Thus, complete concordance of LAL reactivity and signature fatty acid analysis was observed. 3-OH fatty acids (C:14, C:16) were also reported in LAL-positive cyst fluids by a separate reference laboratory (Microbiological Insights, Inc., Knoxville, TN). Additional chemical analyses of cyst fluid are required before a classic signature fatty acid profile and linkage to one or more bacterial genera are possible. Also, we cannot discount the possibility that 3-OH fatty acids released during degradation of endotoxin were incorporated into mammalian sphingolipids that were positive in the LAL assay, thereby accounting for both the presence of such fatty acids and LAL reactivity in cyst fluids. (1[-]3)-ß-D-Glucans (ß-DG) In addition to endotoxin, (1[-]3)-ß-D-glucans were identified in cyst fluids from two patients by differential activation of the LAL assay (Table 1). The range of ß-DG reactive material in cyst fluids was estimated at 40 to 160 pg/ml. In plasma of healthy persons, levels of ß-DG are lower than 6.9 pg/ml (26). ß-DG, a ubiquitous constituent of filamentous fungal and yeast cell walls (33), is exceeded only by endotoxin in its reactivity in the LAL assay; glucans lacking a 1[-]3 linkage are not LAL reactive (34), nor are mannans, dextrans, and cellulose (24,26). Although diverse forms of glucans are components of fungal cell walls, those with (1[-]3)-ß linkages are the most potent in causing hypersensitivity pneumonitis and other severe pulmonary illnesses (35). Although ß-DGs are indicative of fungal cell walls, their occurrence alone does not identify the genera and species of the fungus that produced it. To confirm the presence of fungal components and determine the source of ß-DG, serologic tests were performed on three ß-DG positive and two ß-DG negative cyst fluids from three autosomal-dominant PKD patients (Table 2). Cyst fluid from donor 6 that was negative for LAL-reactive material was also free of detectable fungal antigens and anti- from both kidneys containing ß-DG-positive material (donors 4 and 5; Table 1) were also positive for fungal antigens. Fluid from donor 5 also exhibited fungal antibodies; fluid from donor 4 was not tested for antibodies to fungi. Table 2. Serologic results of five cyst fluids from three autosomal-dominant PKD patients tested for fungal antigens or antibodies to fungal components --------------------------------------------------------------- Donor;Cyst No. LAL(a) Findings Serologic Findings --------------------------------------------------------------- D6;1 Neg. Et(b);Neg. Antigens not detected ß-DG(c) D6;2 Neg. ET;Neg. IgE and IgG reactive with fungi ß-DG were not detected D4;3 Neg. ET;Pos. Antigens: Fusarium solani at 1:2 ß-DG dilution; Aspergillus galactomannan at >50 ng/ml D5;4 Neg. ET;Pos. Antigens: Aspergillus ß-DG galactomannan at >50 ng/ml; Candida albicans serotype A mannan at 10 ng/ml D5;5 Neg. ET;Pos. IgE reactive with Fusarium ß-DG moniliforme; C. albicans (weak positive) --------------------------------------------------------------- (a)Limulus amebocyte lysate assay (b)Endotoxin (c)ß-D-glucan Fungal serology was performed on three cyst fluids from donors 4 and 5; (Table 1) with ß-DG positivity and two cyst fluids from donor 6, which were negative for both endotoxin and ß-DG after extended incubation in the LAL assay. Fluids were tested for antibody to Penicillium notatum (Penicillium chrysogenum) and Penicillium frequentans, Aspergillus fumigatus, Candida albicans (yeast), and Fusarium moniliforme. The Pharmacia CAP systems RAST FEIA (IgE) and IgG FEIA were employed (Pharmacia & Upjohn Diagnostics, Kalamazoo, MI, USA). The tests were modified by substituting cyst fluid for plasma; interference of fluid with the test was not observed. Tests to detect fungal antigens were performed by the Centers for Disease Control and Prevention, Atlanta, GA. To detect Fusarium sp. antigen, a modified aspergillosis microimmunodiffusion test (36) was used with experimental rabbit anti-Fusarium solani antibody; kidney cyst fluid was substituted for plasma. A double-antibody sandwich enzyme immunoassay was used to detect C. albicans serotype A mannan concentrations in cyst fluids; specificity of this test in sera is reported as 100% (37). An experimental ELISA inhibition assay was used to detect Aspergillus galactomannan (Steven Hurst, unpub. protocol) Standard serum reference curves were used for extrapolating quantities of C. albicans mannan and Aspergillus galactomannan in cyst fluids. However, these tests were not designed for cyst fluids, but for serum antigen detection, and must, therefore, be viewed as estimated quantities. Fungal serologic tests provided insights into potential sources of ß-DG. Initial measurements showed Fusarium solani antigen. These findings suggest the antigen to be from F. solani or a shared antigen present in other Fusarium species (L. Kaufman, pers. comm.). IgE (but not IgG) antibody to Fusarium moniliforme was also detected. Aspergillus galactomannan antigen and Candida albicans serotype A. mannan were present in selected cyst fluids. Cross-reactivity of Fusarium with Aspergillus and Penicillium is unlikely as 1) the Fusarium antibody (prepared against the mycelium) was cross-absorbed with Aspergillus, and 2) the immunodominant group of Aspergillus and Penicillium species, galactomannan with a galactofuranosyl moiety (38), is absent in Fusarium species (39). As the serologic tests for Fusarium and Aspergillus in cyst fluids are experimental and have not been evaluated clinically, these data are indirect presumptive indication of the presence of these fungal antigens. The paucity of fungal serologic and chemical methods for detection and identification of emerging fungal pathogens in human tissues and body fluids and fungal components in the human diet has been noted by others. Also detected were IgE antibodies to Candida. IgE antibodies to both Fusarium and Candida in cyst fluid suggest recruitment of immunologic defenses against fungi. The site of production of these IgEs and route of entry into the cyst are unknown; a hypersensitivity reaction cannot be discounted. In human and experimental PKD, the severity of cystic disease correlates with the numbers of circulating neutrophils; neutrophilia is related to exposure to endotoxin and cytokines, both of which have been reported in cyst fluids (16). Our finding of fungal antigens and antibodies raises the additional possibility of leukocyte activation in PKD by ß-DG and mannan released from fungi, as ß-DG and mannan have been reported to stimulate cytokine production (40). Serologic testing is frequently used to detect fungal infection. Cyst fluids collected from PKD patients at sequential times during progressive stages of the disease were not feasible. Therefore, quantitative and/or qualitative changes in antigen or antibody titers could not be used to determine active fungal infections in these patients. Although antigens of Aspergillus or Fusarium species are generally interpreted as apparent or covert infection, another possibility is the absorption and distribution of fungal components independent of infection (i.e., mycotoxicosis versus infection). While Aspergillus enters primarily by inhalation, this route does not appear to be the predominant source of Fusarium; fewer than 1% of air samples contained Fusarium species (41). Fumonisin from Fusarium is present in grains, rice, and corn consumed by humans (42), with regional variations in levels and the type and processing of dietary product. Because of their occurrence in the food supply and their effect on experimental animals, it has been proposed that fumonisins may contribute to kidney disease in humans (43). ß-D-Glucans and mannans are shed by fungi during growth (26,39) and thus, like bacterial endotoxin, can potentially be distributed through blood and lymph. Diverticular disease and other anomalies in the structural and functional integrity of the gut may occur in up to 80% of PKD patients (2,44). In addition to diminished barriers to the absorption of gut-derived endotoxin, the outpouchings (diverticula) become overgrown by minor subpopulations of gut microflora (45), thereby generating increased quantities of unusual mixtures of potentially absorbable microbial components. Diverticular disease (44) and acquired renal cystic disease (46) occur in patients on hemo- and peritoneal dialysis. To complete the symmetry of this line of reasoning, outpouchings of the renal tubule in PKD are described as both cysts and diverticula (2). Direct measurement of intracyst pressure and elasticity of the basal lamina have led to the rejection of the obstruction hypothesis (i.e., a physical balloon inflation) of cystogenesis in favor of a cell-mediated restructuring of the basal lamina coupled with electrolyte transport into the cyst to expand intracyst volume (47). Although diverticular disease is thought to be a pressure-driven lesion, gut diverticula in PKD and dialysis patients may also involve a cellular lesion further promoted by pressure. Thus, diverticula in kidney and gut are associated with microbial components. It is not known if the processes of renal cystogenesis, formation of gut diverticula, and the walling off of infecting material are all facets of the same defense response in humans. Endotoxin in relatively high concentrations was found in fluid from a simple cystic kidney (Table 1); intestinal or biliary obstruction and urinary tract infections have been associated with simple kidney cysts (2). Although endotoxin has been proposed as being associated with "high sodium cyst fluids" (47), we observed endotoxin in cyst fluids of low and high sodium content (data not shown). Relevant to our study is the report of the capacity of ß-DG to prime cell systems, which results in sensitization to bacterial endotoxin and infection (48), an example of ß-DG-endotoxin enhancement; ß-DG and endotoxin also demonstrate a strong synergistic effect on macrophages (49). In addition, there have been reports of synergy between mycotoxin and endotoxin (50). Detection of Fungal DNA To identify fungal DNA as evidence of past or current fungal infection and/or the absorption and distribution of fungal components to kidney cysts, polymerase chain reaction (PCR) methods were used to amplify and thus detect fungal DNA in PKD cyst fluids and kidney tissue. Six cyst fluids from three patients and two samples of kidney tissue from two autosomal-dominant PKD patients were tested; all were positive for fungal DNA. A sample of normal human kidney was negative for fungal DNA (Figure 2 A-C). Because culture confirmation was not achieved from the cyst fluids, expanded studies with species-specific probes are warranted. [Figure 2] [Figures not available in ASCII version] Figure 2. Amplification results of normal and PKD kidney tissue and cyst fluids with universal fungal primers ITS 1 and NL 4. 2A: DNA from healthy human kidney tissue diluted 1:10, 1:100 and 1:1,000 (lanes 1-3); control fungal DNA, A. tamarii (lane 4); negative control (lane 5); 1 kb ladder (lane 6); arrow indicates migration front. 2B (NL 4) and 2C (ITS 1): two cyst fluids, donor 6, negative for detectable endotoxin and ß-DG (lanes 1 and 5); two cyst fluids, donor 4, positive for ß-DG (lanes 2 and 3) and positive for Fusarium solani antigen (lane 3); two cyst fluids, donor 5, positive for ß-DG (lanes 4 and 6); two PKD kidney tissues, donor 5 (lane 7) and donor 4 (lane 8); negative control (lane 9). Large arrows in 2B and 2C point to 560 bp molecular weight marker; small arrows point to product bands. Polymerase Chain Reaction Specimens for PCR included 1) normal human kidney tissue (0.46 g) from a 7-year-old girl who died of a head injury; the kidney was not transplantable because of the presence of a hematoma but was otherwise normal; the section used for PCR excluded the area of hematoma. 2) 0.5 g of cystic tissue, devoid of cyst fluid, from each of two autosomal-dominant PKD patients (donors 4 and 5, Table 1). 3) multiple cyst fluids (0.5-1.0 ml each; donors 4, 5, and 6). The positive control consisted of DNA extracted from A. tamarii (NRRL 26010) plus primer. The CTAB extraction method for fungal genomic DNA was employed. The universal oligonucleotide primer pair ITS 1 and NL4 for fungi, as previously described (51), was used; NL 4 is the reverse primer. PCR master mix (37) with 1.5 mM MgCl2 and primers in a final reaction volume of 100 ml was subjected to the following thermal cycler parameters (Perkin Elmer Thermo Cycler 1): 96°C—30 sec; 53°C—30 sec and 72°C—30 sec for 40 cycles, followed by a final 7 min extension at 72°C and soak at 4°C. The presence of the expected molecular weight PCR products (600 bp) was confirmed by ethidium bromide staining after separation on a 1.0 % agarose gel. The amplified products were compared visually for similarity on the basis of the presence or absence of bands; variations in band intensity were not considered. A-C represent the banding patterns obtained by agarose gel electrophoresis of healthy kidney tissue, cystic kidney tissues, and cyst fluids following PCR amplification with the universal fungal primer pair, ITS 1 and NL 4. Amplified fungal products were not detected in the negative PCR controls (2A, lane 5; 2B and C, lanes 9) or normal human kidney tissue (2A, lanes 1-3). In marked contrast, distinct bands of the predicted size of each fungal primer used ( ~ 600 bp; 45) were detected in all cystic kidney tissues and fluids examined from the three patients (2B-C); minor fragments were not detected. The migration patterns were consistent with the positive fungal DNA control (2A, lane 4). Although fungal DNA might have been anticipated in tissues and fluids from PKD kidneys showing ß-DG or positive serologic findings, fungal DNA was also found in PKD cyst fluid from donor 6 (2B and C: Lanes 1 and 5), which lacked these components. The ß-DG positive cyst fluids tested from donors 4 and 5 are in Lanes 2 and 3 and 4 and 6, respectively. The fluid depicted in Lane 3 also had positive serologic results for F. solani antigen; serologic testing was not done on the other fluids assayed by PCR. Each cyst fluid must be considered an independent sample, requiring direct measurement; assumption of cyst content on the basis of other fluids within the same kidney is not valid (16). Fungal DNA was also detected in kidney tissue from donors 4 and 5 (Figure 2B and C; Lanes 8 and 7). Differences were noted between the two primers used; ITS 1 yielded amplified products in all PKD samples while NL 4 amplified less well, being more concordant with the detection of ß-DG. The amplicons are presumptive evidence of fungal DNA. Despite substantial effort, we have not been able to culture either bacteria or fungi from PKD cyst fluids by axenic methods, but fungi were detected in cultured epithelial cells from PKD kidney tissue (see below); methods appropriate to culture L-forms or other cell-wall-defective microbes were not performed. Gram stains of cyst fluid supernates and pellets did not show intact bacteria. Electron microscopy also did not show intact bacteria, but occasionally, a field consistent with fungal cell walls was observed (not shown); intact fungi were not observed. Nonetheless, it was only from PKD kidneys where ß-DG was identified in cyst fluid that fungal organisms were frequently isolated from PKD epithelial cell cultures. Other human and animal cells isolated and propagated in the laboratory by the same reagents and work spaces were free of fungal growth. The fungi were identified as belonging to the genera Paecilomyces and a new species of Penicillium (manuscript in preparation). Fungi have been reported, albeit infrequently, as etiologic agents in renal infections in PKD (8). Given all of the above, it is possible that viable fungi were present in the PKD renal tissue, but only their remnants were in the cyst fluid. Emerging human awareness of infectious disease may well describe our experience in this study of PKD. Infectious Disease, Microbial Toxicosis, and Sphingolipid Biology Emerging knowledge of sphingolipid biology and PKD's vulnerability to microbial toxins offer an opportunity for a fresh look at PKD. As Spiegel and Merrill (52) have noted, sphingolipids fall into two broad categories, both of which are altered in PKD (53,54). Complex sphingolipids (i.e., ceramide with a carbohydrate or phosphocholine head group on carbon-1) interact with growth factor receptors and the extracellular matrix and adjacent cells and act as binding sites for gram-positive and -negative bacteria and microbial toxins. In the second category of sphingolipids, ceramide sphingoid bases (i.e., sphingosine, sphinganine, phytosphingosine) and their 1-phosphates modify the activity of protein kinases and phosphatases, ion transporters, and a growing number of signal transduction processes. However, the dynamics of human sphingolipid biology occur within the context of a microbe-dominated environment. Thus, we propose a third category called "microsphingoids," sphingolipid-like molecules of microbial origin that mimic or antagonize the actions or metabolism of human sphingolipids. Examples include, but are not limited to, various mycotoxins (42,55-57), bacterial sphingolipids (58), and endotoxin (59,60). In this report, we have shown the presence of endotoxin and fungal antigens or antibodies to at least Fusarium, Aspergillus, and Candida in human PKD tissues and fluids; from human PKD cells in vitro we have encountered Paecilomyces and Penicillium. These fungi produce mycotoxins that inhibit multiple enzymes required for sphingolipid biosynthesis (55; Figure 3) and alter the activity of various elements of signal transduction cascades, such as protein phosphatases, calmodulin, and GTP-binding proteins (56,61). Such mycotoxins are also found in the human diet, which is itself an emerging concern in food safety (42,43,55). Rietschel et al. (13) noted the similarity of LPS to glycosphingolipids. Wright and Kolesnick (59) have reviewed the structural similarity of the Lipid A region of bacterial LPS with ceramide and the ability of LPS to mimic the ceramide-induced alterations in protein kinase and phosphatase activities. Endotoxin is also reported to alter the structure of mammalian sphingolipids (62) and to initiate cytokine-mediated cascades that generate ceramide, sphingosine-1-phosphate, and lysosphingolipids, all of which exhibit biologic activity (13,63). Not to be ignored are bacterial sphingolipids formed by genera such as Bacteriodes, which represent approximately 30% of the gut microflora (58). The role of bacterial sphingolipids and their metabolites in human biology and their bioavailability in disease are poorly understood. The term "microsphingoid" is intended to highlight the contribution of microbes to sphingolipid biology in human health and disease. [Figure 3] [Figures not available in ASCII version] Figure 3. Sites of impact of endotoxin and mycotoxins on sphingolipid metabolism. In PKD, renal sphingolipid formation is altered. Such compromised sphingolipid pathways would be expected to be vulnerable to these highly potent microbial toxins, especially during chronic exposure within renal cysts. Could pertubations in sphingolipid biology caused by genetic anomalies and/or "microsphingoids" account for both infantile autosomal recessive and adult onset forms of kidney cystic disease? Hannun (64) has reviewed the role of sphingolipids as "biostats" that regulate diverse cellular programs executed in response to various stimuli. Such biostatic regulation could account for both acute and chronic changes in cellular behavior and differentiation in the kidney (65). Calvet et al. (2,66) have proposed two models to explain the immaturity or dedifferentiated state of epithelial cells found in hereditary and acquired cystic kidneys: In infantile cystic disease, the epithelial cells never reach terminal differentiation and are trapped in an immature state, while in adult forms of cystic disease, toxin-induced injury to an initially mature renal epithelium is followed by inability of the epithelium to recover to a fully differentiated state. In genetically cystic cpk/cpk mice (a model for autosomal recessive PKD), Deshmukh et al. (53) reported altered levels of ceramide and complex glycosphingolipids in kidney tissue from cystic mice, but not in their phenotypically normal littermates. Lower levels of ceramide and sulfatide, but higher levels of glucosyl- and lacto-sylceramide and ganglioside GM3, were measured. Our research in infantile and adult human PKD kidney tissue and cyst fluids showed no detectable free sphinganine, the primary sphingoid base formed during de novo biosynthesis of mammalian sphingolipids (54). Thus, anomalies in sphingolipid biology exist in cystic kidney tissue. It is difficult to separate concepts of sphingolipid biology from considerations of infectious disease, microbial components, and "microsphingoids" in PKD. Potential consequences of alterations in glycosphingolipids on the surface of PKD cells include enhanced microbial colonization due to the availability of complex sphingolipids as binding sites. Binding of microbes or their components to such sphingolipids may even promote cystogenesis, as binding to complex sphingolipid has been reported to cause changes in differentiation and morphology of cells in vitro (67). Altered biosynthesis of sphingoid bases affects the ratios of sphinganine to sphingosine with consequences to signal transduction (61) and may even alter the antimicrobial environment, as sphingoid bases are reported to have direct antifungal and antibacterial activity (68). The levels of sphingosine in human cyst fluid (Hjelle, unpub.) are comparable to the levels that induce a state of cytoresistance (cellular dedifferentiation) in kidney cells in vitro (69). In addition to products of mammalian sphingolipid metabolism, endotoxin in relatively high amounts was found in cyst fluids from infantile and adult forms of PKD and in simple cysts (Table 1). Could "microsphingoids" or microbial toxins injure and then prevent repair of renal epithelial cells? Data from diverse scientific disciplines support this possibility. LPS influences nephron formation (70) and renal cystogenesis (11). Fumonisins are potent nephrotoxins (43,55), alter repair mechanisms in kidney cells in vitro (71), and induce apoptosis (72,73). Renal cysts are occasionally reported after chronic exposure of rodents to fumonisins (74). Rates of programmed cell death are abnormal in PKD kidney tissue (75,76); ceramide is a pivotal messenger in apoptosis (64). In PKD, altered processing and sorting of cell membrane proteins and secretory material occurs (2-4); sphingolipids influence processing, sorting, and movement of membranes and ion transporters (64,65), as does fumonisin in kidney cells in vitro (77). In PKD, various electrolyte transport systems are altered (2). cAMP-mediated electrolyte fluxes were proposed as important in cyst formation (3). Fumonisins are reported to activate cAMP response elements (78). Cyst fluid contains uncharacterized substances that promote cystogenesis in vitro (3). Although LPS isolated from Escherichia coli did not induce the full array of anticipated cystogenic responses in kidney cells in vitro, the structure, potency, and array of elicited biologic responses of endotoxin depend on the genera and species of bacteria from which it was isolated (13). Coupled with the presence of fungal components, cyst fluid likely represents a complex mixture of "microsphingoids" and toxins that may change over time with dynamic consequences to cyst formation. The heterogeneity of cyst volume and content of growth factors and cytokines in adult PKD has been noted (3,16). Concepts of infection and "microsphingoids" appear to converge with the expanding knowledge of PKD gene products. The structures of the PKD1 (polycystin) and PKD2 gene products share homology with a1E subtype of voltage-activated, calcium channels (3,6) and a sea urchin protein likely involved in calcium fluxes during fertilization (79). LPS alters voltage-activated, calcium channels (80) and osmoregulation (81) in mammalian cells. The PKD1 gene product also contains regions of homology with ligand and receptor domains putatively involved in binding to adjacent cells and extracellular matrix (3); one such domain is similar to C type lectins that can bind microbes (82). Tissues, including kidney and gut, expressing polycystin in adult PKD, may exhibit a relatively greater leakiness to normal molecular and particulate traffic, as seen in kidney cysts (3) and susceptibility to diverticulosis (3,44). Polycystin also shows homology with apoprotein from low density lipoprotein. Because LPS and sphingolipids bind to and are transported by serum lipoproteins, the low-density lipoprotein binding site in polycystin may also enable accumulation and/or transport of "microsphingoids." Secondary mutations in PKD genes appear to be required for clonal cyst formation (3,5), as is a loss of renal tissue through dysregulation of apoptosis (76). Alterations in the expression of the bcl-2 gene product in mice results in polycystic kidneys and dysregulation of apoptosis (83). Although infection increases translocation of the bcl-2 gene in human lymphoid tissue (84), it is not known if infection in PKD patients causes such a dysregulation of bcl-2 in kidney tissue. Regarding infection and sphingolipids, ceramide is emerging as a pivotal molecule in the immune system (63) and fumonisins are reported to alter immune function (85). It is ironic that our findings potentially link Fusarium to PKD, as fumonisin is used as a molecular tool to study sphingolipid metabolism and signal trandsduction in PKD. Not to be overlooked are the classic bacterial sphingomyelinases encountered during infection and released from gut microflora (e.g., Staphylococcus aureus and Clostridium perfringens) that can stimulate ceramide formation by hydrolysis of sphingomyelin. Thus, the vulnerability of PKD patients to infection may be related, in part, to anomalies in sphingolipid biology that influence 1) "biostatic" mechanisms of cell regulation, 2) the structure of the plasma membrane and the function of PKD gene products, 3) the availability of glycosphingolipids as binding sites for microbes and their components, 4) the bioavailability of microbial components present in the gut, and 5) antimicrobial defenses in general. Such vulnerability is likely influenced by repeated courses of antimicrobial therapy that provide selection pressure for colonization with a modified microflora. The extent to which sphingolipid biology in PKD is influenced by genetic defects rather than microbial factors is yet to be defined. Anomalies caused by the PKD gene defect(s) alone cannot explain cystogenesis. As shown by Werder et al. (9), raising genetically cystic mice in a germ-free environment essentially eliminated cystogenesis and increased survivorship to nearly 100% over that of littermates raised in ambient environment for 18 months. Even in cyst fluid from infantile PKD, relatively high levels of endotoxin were found (Table 1). This suggests that microbial toxins are available early in this disease. Prenatal exposures to toxins and "microsphingoids" are unknown. Although our finding of fungal DNA in eight of eight samples of autosomal-dominant PKD tissue and cyst fluids examined suggests an intimate association of fungal exposure to renal cysts, a contributing multifaceted microbial toxicosis involving diet and gut microflora cannot be excluded. By itself, the finding of microbial components at the site of lesion does not prove a causal role for the microbe(s) in disease progression (1). However, a working hypothesis can be formed on the basis of evidence that microbes promote progression of the primary disease and components of the microbes act on mammalian biology to cause effects plausibly related to the known pathophysiology of the disease. Although there is an established body of knowledge that PKD is a genetic disorder, our data indicate that bacterial endotoxin, ß-DG, and likely other microbial components are available within the kidney to provoke cystogenesis. We have provided chemical and advanced LAL assay-based evidence of bacterial endotoxin and ß-DG in human PKD cyst fluids. From cyst fluids and PKD kidney tissue we have provided evidence of fungal DNA and cell components by serologic testing and PCR with universal fungal primers. We have integrated these findings into a working hypothesis based on emerging knowledge of PKD gene products, altered sphingolipid metabolism in PKD, the effects of LPS on renal cystogenesis, the mimicry of ceramide by LPS and the effects of mycotoxins on mammalian sphingolipid biology and signal transduction, the occurrence of infection in PKD, and the impact of altered gut permeability and microbial colonization on progression of PKD. Is PKD a genetic disease promoted by microbial influences? Tests of this multifaceted hypothesis require awareness of a breadth of issues drawn from numerous scientific disciplines. Identification of the microbes and microbial components involved will require a concerted analysis using highly sensitive and specific methods. As awareness of the importance of sphingolipid biology in health and disease grows, so will the appreciation that microbial influences will need to be considered in pharmacologic studies that seek to manipulate ceramide and complex sphingolipid biochemistry in disease. The ubiquitous and highly potent bacterial endotoxin is again one of the usual suspects examined as provocateur of disease; in this case, endotoxin's modus operandi of coopting the signal transduction machinery of ceramide to cause chronic disease may ultimately be revealed. Acknowledgments This research was supported by grants and gifts from the Methodist Medical Center Foundation; the Children's Miracle Network Telethon; and the Campus Research Board, University of Illinois. We thank Dr. Jim Cooper for his advice, counsel, and support during the endotoxin experiments and preparation of the manuscript; Dr. Kerry O'Donnell for analysis of specimens by PCR for fungal DNA; Dr. Christine Morrison (Candida mannan), Dr. Leo Kaufman (Fusarium antigen), and Mr. Steven Hurst (Aspergillus galactomannan) for fungal serologic tests for antigens; and Dr. Hun-Chi Lin for fungal serologic tests for antibodies. We also thank Jonathan R. Lane and Robert V. Acuff, for the use of, and advice regarding, the gas-chromatograph-mass spectrometer. Dr. Miller-Hjelle is professor of Microbiology and Diplomate, American Board of Medical Microbiology. References 1. Fredricks D, Relman D. Sequence-based identification of microbial pathogens: a reconsideration of Koch's postulates. Clin Microbiol Rev 1996;9:18-33. 2. Martinez RR, Grantham JJ. Polycystic kidney disease: Etiology, pathogenesis, and treatment. Dis Mon 1995;41:698-765. 3. Grantham JJ. The etiology, pathogenesis, and treatment of autosomal dominant polycystic kidney disease: recent advances. Am J Kid Dis 1996;28:788-803. 4. Carone FA, Bacallao R, Kanwar YS. The pathogenesis of polycystic kidney disease. Histol Histophathol 1995;10:213-21. 5. Brasier JL, Henske EP. Loss of the polycystic kidney disease (PKD1) region of chromosome 16p13 in renal cyst cells supports a loss-of-function model for cyst pathogenesis. J Clin Invest. In press. 6. Mochizuki T, Wu G, Hayashi T, Xenophontos SL, Veldhuisen B, Saris JJ, et al. PKD2, a gene for polycystic kidney disease that encodes an integral membrane protein. Science 1996;272:1339-42. 7. Schwab S, Bander S, Saulo K. Renal infection autosomal dominant polycystic kidney disease. Am J Med 1987;82:714-8. 8. Sklar A, Caruana RJ, Lammers JE, Strauser GD. Renal infection in autosomal dominant polycystic kidney disease. Am J Kidney Dis 1987;10:81-8. 9. Werder AA, Amos A, Nielsen AH, Wolfe GH. Comparative effects of germfree and ambient environments on the development of cystic kidney disease in CFWwd mice. J Lab Clin Med 1984;103:399-407. 10. Gardner KD Jr, Evan AP, Reed WP. Accelerated renal cyst development in deconditioned germfree rats. Kidney Int 1986;29:1116-23. 11. Gardner KD Jr, Reed WP, Evan AP, Zedalis J, Hylarides MD, Leon AA. Endotoxin provocation of experimental renal cystic disease. Kidney Int 1987;32:329-34. 12. Munford R, Hall C, Lipton J. Biologic activity, lipoprotein-binding behavior and in vivo disposition of extracted and native forms of Salmonella typhimurium. Clin Invest 1982;70:877-88. 13. Rietschel ET, Kirikae T, Schade FU, Mamat U, Schmidt G, Loppnow H, et al. Bacterial endotoxin: molecular relationships of structure to activity and function. FASEB J 1994;8:217-25. 14. Wilkinson SG. Gram-negative bacteria. In: Rutledge G, Wilkinson SG, editors, Microbial Lipids, Vol. 1. New York: Academic Press, 1988:431-57. 15. Miller MA, Prior RB, Horvath FJ, Hjelle JT. Detection of Endotoxiuria in polycystic kidney disease patients by the use of the Limulus Amoebocyte lysate assay. Am J Kid Dis 1990;15:117-22. 16. Gardner KD Jr, Burnside J, Elzinga L. Cytokines in fluids from polycystic kidneys. Kidney Int 1991;39:718-24. 17. Nolan JP. Intestinal endotoxins as mediators of hepatic injury--an idea whose time has come again. Hepatology 1989;10:887-91. 18. Deitch E, Berg R, Specian R. Endotoxin promotes the translocation of bacteria from the gut. Arch Surg 1987;122:185-90. 19. Mimura Y, Yamanaka K, Kawabata R, Inoue A, Sasatomi K, Koga H, et al. Lipopolysaccharide in rheumatoid arthritis. Journal of Endotoxin Research 1996;3:17. 20. Muhlestein JB, Hammond EH, Carlquist JF, Radicke E, Thomson MJ, Karagounis LA, et al. Increased incidence of Chlamydia species within the coronary arteries of patients with symptomatic atherosclerotic versus other forms of cardiovascular disease. J Am Coll Cardiol 1996;27:1555-61. 21. Raetz CRH, Ulevitch RJ, Wright SD, Sibley CH, Ding A, Nathan CF. Gram negative endotoxin: an extraordinary lipid with profound effects on eukaryotic signal transduction. FASEB J 1991;5:2652-60. 22. Prior RB. The Limulus amoebocyte lysate test. In: Prior RB, editor. Clinical applications of the Limulus amoebocyte lysate test. Boca Raton (FL): CRC Press; 1990;27-36. 23. Zhang GH, Baei L, Buchardt O, Koch C. Differential blocking of coagulation-activation pathways of Limulus amoebocyte lysate. J Clin Microbiol 1994;32:1537-41. 24. Obayashi T, Tamura H, Tanaka S, Ohki M, Takahashi S, Kawai T. Endotoxin-inactivating activity in normal and pathological human blood samples. Infect Immun 1986;53:294-7. 25. Morrison DC, Jacobs DM. Binding of polymyxin B to the lipid A portion of bacterial lipopolysaccharides. Immunochem 1979;13:813-8. 26. Miyazaki T, Hohno S, Mitsutake K, Maesaki S, Tanaka K, Hara K. (1-3)-ß-D-glucan in culture fluid of fungi activates Factor G, a Limulus coagulation factor. J Clin Lab Anal 1995;9:334-9. 27. Levi ME, Eshaghi N, Smith JW, Elkind C. Fever of unknown origin following an upper gastrointestinal series in a patient with polycystic kidney disease. S Med J 1995;88:769-70. 28. Lowry O, Rosebrough N, Farr A, Randall R. Protein measurement with the Folin phenol reagent. J Biol Chem 1951; 193:265-75. 29. Douwes J, Doekes G, Montijn R, Heedrik D, Brunekreef B. Measurement of ß (1-3)-glucan in occupational and home environments with an inhibition enzyme immunoassay. Appl Envir Microbiol 1996;62:3176-82. 30. Miyazaki T, Kohno S, Mitsutake K, Yamada H, Yasuoka T, Malsaki S, et al. Combination of conventional and endotoxin-specific Limulus tests for measurement of polysaccharides in sera of rabbits with experimental systemic Candadiasis. Tohoku J Exp Med, 1992;168:1-9., 31. Sturk A, VanDeventer S, Wortel C. Detection and clinical relevance of human endotoxemia. Zeitschrift fuer Medizinische Laboratoriums diagnostik 1990;31:147-58. 32. Mayberry WR, Lane JR. Sequential alkaline saponification/acid hydrolysis/esterification: a one-tube method with enhanced recovery of both cyclopropane and hydroxylated fatty acids. J Microbiol Methods 1993;18:21-32. 33. Yoshida M, Roth RI, Grunfeld C, Feingold KR, Levin J. Soluble (1-3)-ß-D-glucan purified from Candida albicans: biologic effects and distribution in blood and organs in rabbits. J Lab Clin Med 1996;128:103-14. 34. Ikemura K, Ikegama K, Shimazu T, Yoshioka T, Sugimoto T. False positive results in Limulus test caused by Limulus amoebocyte lysate-reactive material in immunoglobulin products. J Clin Microbiol 1989;27:1965-8. 35. Williams D. (1-3)-ß-D-Glucan. In: Rylander R, Jacobs R, editors. Organic dusts: exposure, effects, and prevention. Boca Raton (FL): Lewis Publishers, 1994;83-5. 36. Kaufman L, Reiss E. Serodiagnosis of fungal diseases. In: Rose N, deMacario E, Fahey J, Friedman H, Penn G, editors. Manual of clinical laboratory immunology. Washington (DC): American Society for Microbiology, 1992:506-28. 37. Innis M, Gelfand D. Optimization of PCRs. In: Innis M, Gelfand D, Sninsky J, White T, editors. PCR protocols-a guide to methods and applications. New York: Academic Press 1990:3-12. 38. Latge J-P, Kobayashi H, Debeaupuis J-P, Diaquin M, Sarfati J, Wieruszeski JM, et al. Chemical and immunological characterization of the extracellular galactomannan of Aspergillus fumigatus. Infect Immun 1994;62:5424-33. 39. Notermans S, Dufrenne J, Wijnands L, Engel H. Human serum antibodies to extracellular polysac-charide (EPS) of moulds. J Med Vet Mycol 1988;26:41-8. 40. Garner R, Hudson J. Intravenous injection of Candida-derived mannan results in elevated TNFa levels in serum. Infect Immun 1996;4561-66. 41. Roby R, Sneller M. Incidence of fungal spores at the homes of allergic patients in an agricultural community. II. Correlations of skin test with mold frequency. Ann Allergy Asthma Immunol 1979;43:286-8. 42. De Nus M, Rombouts F, Notermans S. Fusarium molds and their mycotoxins. Journal of Food Safety 1996;16:15-58. 43. Badria FA, Li S, Shier WT. Fumonisins as potential causes of kidney disease. Journal of Toxicology-Toxin Reviews 1996;15:273-92. 44. Scheff R, Zuckerman G, Harter H, Delmez J, Koehler R. Diverticular disease in individuals with chronic renal failure due to polycystic kidney disease. Ann Intern Med 1980;92:202-4. 45. Gans H, Matsumoto K. The escape of endotoxin from the intestine. Surgery, Gynecology and Obstetrics 1974;139:395-402. 46. Grantham JJ. Acquired cystic kidney disease. Kidney Int 1991;40:143-52. 47. Gardner KD Jr, Glew RH, Evan AP, McAteer JA, Bernstein J. Why renal cysts grow. Am J Physiol 1994;266:F353-9. 48. Cook J, Dougherty W, Holt T. Enhanced sensitivity to endotoxin induced by the R-E stimulant, glucan. Circulatory Shock 1980;7:225-38. 49. Rylander R. Endotoxin in the environment. In: Levin J, Alving C, Munford R, Redl H, editors. Bacterial endotoxin: lipopolysaccharides from genes to therapy. New York: Wiley-Liss, Inc. 1995;392:79-90. 50. Miller J. Mycotoxins. In: Rylander R, Jacobs R, editors. Organic dusts: exposure, effects and prevention. Boca Raton (FL): Lewis Pubishers, 1994;87-92. 51. O'Donnell K. Progress towards a phylogenetic classificaton of Fusarium. Sydowia 1996;48:57-70. 52. Spiegel S, Merrill AH Jr. Sphingolipid metabolism and cell growth regulation. FASEB J 1996;10:1388-97. 53. Deshmukh GD, Radin NS, Gattone V, Shayman JA. Abnormalities of glycosphingolipid, sulfatide, and ceramide in the polycystic (cpk/cpk) mouse. J Lipid Res 1994;35:1611-21. 54. Hjelle JT, Dombrink-Kurtzman M, Nowak DM, Miller-Hjelle MA, Darras F, Dobbie JW. Ceramide pathways in human polycystic kidney disease. Peritoneal Dialysis International 1996;16:S94. 55. Riley RT, Wang E, Schroeder JJ, Smith ER, Plattner RD, Abbas H. Evidence for disruption of sphingolipid metabolism as a contributing factor in the toxicity and carcinogenicity of fumonisins. Nat Toxins 1996;4:3-15. 56. Merrill AH Jr, Liotta DC, Riley RT. Fumonisins: fungal toxins that shed light on sphingolipid function. Trends in Cell Biology 1996;6:218-23. 57. Merrill AH Jr, Grant AM, Wang E, Bacon CW. Lipids and lipid-like compounds of Fusarium. In: Prasad R, Ghannoun MA, editors. Lipids of pathogenic fungi. New York: CRC 1996;199-217. 58. Rutledge G, Wilkinson SG, editors. Microbial lipids, Vol. 1, New York: Academic Press, 1988. 59. Wright SD, Kolesnick RN. Does endotoxin stimulate cells by mimicking ceramide? Immunol Today 1995;16:294-302. 60. Barber SA, Detore G, McNally R, Vogel SN. Stimulation of the ceramide pathway partially mimics lipopolysaccharide-induced responses in murine peritoneal macrophages. Infect Immun 1996;64:3397-400. 61. Ho AK, Peng R, Ho AA, Duffield R, Dombrink-Kurtzman MA. Interactions of fumonisins and sphing-oid bases with GTP-binding proteins. Biochemical Archives. In Press. 62. Portner A, Peter-Katalinic J, Brade H, Unland F, Buntemeyer H, Muthing J. Structural characterization of gangliosides from resting and endotoxin-stimulated murine B lymphocytes. Biochemistry 1993;32:12685-93. 63. Ballou LR, Laulederkind SJF, Rosloniec EF, Raghow R. Ceramide signalling and the immune response. Biochim Biophys Acta 1996;1301:273-87. 64. Hannun Y. Functions of ceramide in coordinating cellular responses to stress. Science 1996;274:1855-9. 65. Shayman JA. Sphingolipids: their role in intracellular signaling and renal growth. J Am Soc Nephrol 1996;7:171-82. 66. Calvet JP. Injury and development in polycystic kidney disease. Curr Opin Nephrol Hyperten 1994;3:340-8. 67. Shayman JA, Radin NS. Structure and function of renal glycosphingolipids. Am J Physiol 1991;260:F291-302. 68. Bibel DJ, Aly R, Shah S, Shinefield HR. Sphingosines: antimicrobial barriers of the skin. Acta Derm Venereol Suppl (Stockh) 1993;73:407-11. 69. Iwata M, Herrington J, Zager RA. Sphingosine: a mediator of acute renal tubular injury and subsequent cytoresistance. Proc Natl Acad Sci USA 1995;92:8970-4. 70. Woolf AS, Neuhaus TJ, Kolatsi M, Winyard PJ, Klein NJ. Nephron formation is inhibited by lipopolysaccaride and by tumor necrosis factor-a. J Am Soc Nephrol 1994;5:641. 71. Counts RS, Nowak G, Wyatt RD, Schnellmann RG. Nephrotoxicant inhibition of renal proximal tubule cell regeneration. Am J Physiol 1995;269:F274-81. 72. Lim CW, Parker HM, Vesonder RF, Haschek WM. Intravenous fumonisin B1 induces cell proliferation and apoptosis in the rat. Nat Toxins 1996;4:34-41. 73. Wang W, Jones C, Ciacci-Zanella J, Holt T, Gilchrist DG, Dickman MB. Fumonisins and Alternaria alternata lycopersici toxins: sphinganine analog mycotoxins induce apoptosis in monkey kidney cells. Proc Natl Acad Sci USA 1996;93:3461-5. 74. Gelderblom WCA, Kriek NPJ, Marasas WFO, Thiel PG. Toxicity and carcinogenicity of the Fusarium moniliforme metabolite, fumonisin B1. Carcinogenesis 1991;12:1247-51. 75. Woo D. Apoptosis and loss of renal tissue in polycystic kidney disease. New Eng J Med 1995;333:18-25. 76. Winyard PJD, Nauta J, Lerienman DS, Hardman P, Sams VR, Risdon RA, et al. Deregulation of cell survival in cystic and dysplastic renal development. Kidney Int 1996;49:135-46. 77. Mays RW, Siemers KA, Fritz BA, Lowe AW, van Meer G, Nelson WJ. Hierarchy of mechanisms involved in generating Na/K-ATPase polarity in MDCK epithelial cells. J Cell Biol 1995;130:1105-15. 78. Huang C, Dickman M, Henderson G, Jones C. Repression of protein kinase C and stimulation of cyclic AMP response elements by fumonisin, a fungal encoded toxin which is a carcinogen. Cancer Res 1995;55:1655-9. 79. Moy GW, Mendoza LM, Schulz JR, Swanson WJ, Glabe CG, Vacquier VD. The sea urchin sperm receptor for egg jelly is a modular protein with extensive homology to the human polycystic kidney disease protein, PKD1. J Cell Biol 1996;133:809-17. 80. Wilkinson MF, Earle ML, Triggle CR, Barnes S. Interleukin-1b, tumor necrosis factor-a, and LPS enhance calcium channel current in isolated vascular smooth muscle cells of rat tail artery. FASEB J 1996;10:785-91. 81. Han J, Lee J-D, Bibbs L, Ulevitch RJ. A MAP kinase targeted by endotoxin and hyperosmolarity in mammalian cells. Science 1994;265:808-11. 82. Malhotra R. Collectin receptor (C1q receptor): structure and function. Behring Inst Mitt 1993;93:254-61. 83. Veis DJ, Sorenson CM, Shutter JR, Korsmeyer SJ. Bcl-2-deficient mice demonstrate fulminant lympoid apoptosis, polycystic kidneys, and hypopigmented hair. Cell 1993;75:229-40. 84. Reed JC. Bcl-2 and the regulation of programmed cell death. J Cell Biol 1994;124:1-6. 85. Martinova EA, Merrill AH Jr. Fumonisin B1 alters sphingolipid metabolism and immune function in BALB/c mice: immunologicial responses to fumonisin B1. Mycopathologica 1995;130:163-70. --------------------------------------------------------------------------- [Emerging Infectious Diseases * Volume 3 * Number 2 * April-June 1997] Synopses Borna Disease Carolyn G. Hatalski, Ann J. Lewis, and W. Ian Lipkin University of California, Irvine, California, USA --------------------------------------------------------------------------- Borna disease virus, a newly classified nonsegmented negative-strand RNA virus with international distribution, infects a broad range of warm-blooded animals from birds to primates. Infection causes movement and behavioral disturbances reminiscent of some neuropsychiatric syndromes. The virus has not been clearly linked to any human disease; however, an association between infection with the virus and selected neuropsychiatric disorders has been suggested. We reviewed recent advances in Borna disease virus research, focusing on evidence of infection in humans. Although Borna disease was first recognized in the early 1800s as a neurologic syndrome with an infectious basis, Borna disease virus (BDV) has only recently been characterized as the causative agent. BDV is the prototype of a newly recognized virus family, Bornaviridae, within the nonsegmented negative-strand RNA viruses (order Mononegavirales) (1,2). The molecular biology of the virus has several unusual aspects, including nuclear localization for replication and transcription (3), overlap of open reading frames and transcription units (4,5), posttranscriptional modification of subgenomic RNAs (6,7), and marked conservation of coding sequence across various animal species and tissue culture systems (8,9). BDV replicates at lower levels than most known viruses (10,11), is not lytic, and persists in the nervous system despite a vigorous immune response. In the classic syndrome, infected animals exhibit movement and behavior disorders (10,12,13); however, clinical signs may be dramatic, subtle, or inapparent depending on the integrity and intensity of the host immune response to viral gene products (14). Natural Infection and Transmission Originally described as a disease of horses, Borna disease has also been found in sheep, llamas, ostriches, cats, and cattle (15). Because an even larger variety of species has been infected experimentally, the host range is likely to include all warm-blooded animals; no data exist concerning infection of species other than warm-blooded hosts. The geographic distribution of BDV is unknown. Natural infection has been reported only in Central Europe, North America, and parts of Asia (Japan and Israel). However, this apparent geographic restriction may reflect lack of reliable methods and reagents for diagnosis of infection or failure to consider the possibility of BDV infection. Recent reports of asymptomatic naturally infected animals suggest that the virus may be even more widespread than previously thought (16-18). Neither the reservoir nor the mode of transmission of natural infection is known. An olfactory route for transmission has been proposed because intranasal infection is efficient, and the olfactory bulbs of naturally infected horses show inflammation and edema early in the course of disease (19,20). BDV nucleic acid and proteins in peripheral blood mononuclear cells (PBMC) also indicate a potential for hematogenous transmission (21-28). Experimental infection of rodents results in virus persistence and is associated with the presence of viral gene products in saliva, urine, and feces (28); such secreta/excreta are important in the transmission of other pathogenic viruses (e.g., lymphocytic choriomeningitis virus and hantaviruses). Thus the rodent provides the potential for both a natural reservoir and vector; however, because natural BDV infection has not been reported in rodents, their role in BDV transmission to other domesticated animals and humans remains speculative. No data concerning vertical transmission of BDV in natural or experimental hosts have been published. Animal Models for BDV Pathogenesis Borna disease in naturally infected horses and sheep is characterized by agitated aggressive behavior that progresses over weeks to paralysis and inanition (29). Because its immune-mediated disease most closely resembles that in naturally infected horses and sheep, the Lewis rat has been selected as a rodent model. Rats infected as adults exhibit hyperactivity and exaggerated startle responses coincident with viral gene products in limbic system neurons and infiltration of mononuclear cells into the brain (13,30). The inflammation recedes over several weeks, but the virus persists and animals show stereotyped motor behavior, dyskinesias, and dystonias associated with distinct changes in the central nervous system (CNS) dopamine system (12,31), as well as decreased activity and cachexia (13). In contrast, rats infected as neonates have a disease characterized by stunted growth, hyperactivity, subtle learning disturbances, and altered taste preferences and do not mount a cellular immune response to the virus (32,33). Behavioral disturbances have been reported in experimentally infected primates: tree shrews and rhesus monkeys. Infected tree shrews have altered social and sexual behavior, manifested as abnormal dominance relationships and failure to mate (34). Infected rhesus monkeys are initially hyperactive and subsequently become apathetic and hypokinetic (35). BDV and Neuropsychiatric Disease Serology (Table 1) Its broad host and geographic range suggests that BDV might cause human neuropsychiatric disease. Because the behavioral disturbances in animals resembled those of affective disorders, particularly bipolar depression, initial studies investigated these disorders. The earliest work to suggest a link between BDV and human mental illness came from a serologic survey in 1985 of 285 patients with affective disorders in the United States, 694 psychiatric patients in Germany, and 200 healthy controls (36). An indirect immunofluorescence assay (IFA) was used to detect antibodies reactive with a BDV-infected cell line; sera from 12 (4.3%) patients from the United States and four (< 1%) patients from Germany were immunoreactive; no sera from controls were immunoreactive. Sera from many of these patients were subsequently analyzed by a Western immunoblot assay based on BDV nucleoprotein (N) and phosphoprotein (P) purified by affinity chromatography from infected rabbit kidney cells (37). In this study of 138 patients with affective disorders and 117 healthy controls, antibodies to N were found in 53 (38%) patients versus 19 (16%) controls; antibodies to P were found in 16 (12%) patients versus five (4%) controls; antibodies to both proteins were found in nine (6.5%) patients versus one (< 1%) control. Table 1. Serum immunoreactivity to Borna disease virus in various diseases --------------------------------------------------------------------------- Disease Prevalence Assay Ref. Disease (%) Controls (%) --------------------------------------------------------------------------- Psychiatric (4/694) 0.6 (0/200) 0 IFA (36) (various) (13/642) 2 (11/540) 2 IFA (60) (200-350/ 4-7 (10/ 1 WB/ (61) 5000) 1000) IFA (18/60) 30 (1/100) 1 WB (24, 25) (18/132) 13.6 (3/203) 1.5 WB (27) (13/55) 23.6 (4/36) 11.1 IFA (51) (6/49) 12.2 IFA (38) Affective (12/265) 4.5 (0/105) 0 IFA (62) (12/285) 4.2 (0/200) 0 IFA (36) (53/138) 38 (19/117) 16 WB (37) (6/52) 11.5 (3/203) 1.4 WB (27) (10/27) 37 IFA (38) Schizophrenia (29/90) 32 (4/20) 20 WB (43) (16/114) 14 (3/203) 1.5 WB (27) (1/4) 25 IFA (38) CFS (6/25) 24 WB (26) MS (15/114) 13 (10/483) 2.1 IP/ (63) IFA HIV- (36/460) 7.8 (11/540) 2 IFA (60) positive HIV-early (61/751) 8.1 (10/483) 2 IP/ (61) IFA HIV-LAP (34/244) 14 (10/483) 2 IP/ (63) IFA Schisto/ (19/193) 9.8 (10/483) 2 IP/ (63) malaria IFA --------------------------------------------------------------------------- Abbreviations: IFA, immunofluorescence assay; WB, Western immunoblot; IP, immunoprecipitation; CFS, chronic fatigue syndrome; MS, multiple sclerosis; HIV, human immunodeficiency virus; LAP, lymphadenopathy; Schisto/malaria, schistosomiasis or malaria. To establish a correlation between immunoreactivity to BDV and the duration and severity of psychiatric disease, Bode et al. performed IFA on multiple serum samples taken at different times from 71 patients with various diagnoses including minor or major depression, paranoid psychosis, schizophrenia, anxiety disorder, and personality disorder (38). Overall, the prevalence of immunoreactivity to BDV was greater than 20%, a marked increase from the 2% to 4% found in an earlier study that assayed specimens from each patient at one time. Thirty-seven percent of patients with major depression, 25% with paranoid psychosis, and only 6% or fewer with reactive depression and other neurotic conditions were seropositive by day 17 of illness. Because BDV gene products have been identified in PBMC of infected rats (28), PBMC from patients with neuropsychiatric diseases were examined for viral antigens by fluorescence activated cell sorting analysis (39). Of the 70 patients tested, more than 40% were antigen carriers, twice the number predicted by the previous serologic survey. Some similarities between particular animal models of BDV infection and schizophrenia have been reported. The subtle signs of disease caused by infection in neonatal rats (e.g., learning deficiencies, hyperactivity with CNS abnormalities including cerebellar disorganization and loss of dentate gyrus granule cells [32,33,40,41]) are consistent with a longstanding hypothesis that schizophrenia reflects an early brain insult (e.g., infection) resulting in abnormal brain development (42) and prompted investigation of the role of BDV infection in the pathogenesis of schizophrenia (43). A Western immunoblot assay based on BDV N, P, and matrix protein (M) purified from infected human neuroblastoma cells was used to examine sera from 90 schizophrenic patients and 20 healthy controls. Antibodies to one BDV protein (N, P, or M) were detected in 29 (32%) patients and four (20%) controls. Antibodies to two or more BDV proteins were detected in 13 (14.4%) patients and zero controls. Antibodies to M protein were found in 12 (13.3%) patients and zero controls. Immunoreactivity to two or more BDV proteins or M protein was significantly associated with abnormal brain morphology in magnetic resonance image analysis (MRI) and the clinical diagnosis of deficit syndrome (a schizophrenia subgroup characterized by social withdrawal, neurologic dysfunction, and neuroanatomic abnormalities). Similar findings indicated an association between antibodies reactive with BDV proteins and MRI evidence of cerebral atrophy in schizophrenic patients (44). Molecular Epidemiology (Table 2) Interest in the potential role of BDV as a human pathogen and in BDV-infected animals as models for human neuropsychiatric diseases guided efforts to identify the infectious agent. Because of low viral productivity and tight association of BDV with plasma membranes, classic methods for virus isolation have been unsuccessful; however, BDV nucleic acids have been independently cloned from horse isolates by using a purely molecular subtractive cloning approach (45,46). The viral genome was subsequently cloned from viral particles (4) and nuclear extracts of infected cells (47). With the advent of viral sequence information, new diagnostic reagents for BDV infection have been introduced, including recombinant proteins for serology as well as oligonucleotide primers and probes for molecular epidemiology. Table 2. Borna disease virus nucleic acid in patients with various diseases --------------------------------------------------------------------------- Disease Tissue Prevalence Divergence* Ref. Disease (%) Controls(%) --------------------------------------------------------------------------- Psychiatric PBMC (4/6)66.7 (0/10) 0 0-3.6 (22) (various) PBMC (5/12)41.7 (0/23) 0 0-4 (27) PBMC (22/60) 37 (8/172)4.7 (24, 25) PBMC-coculture (3/32) 9.4 (0/5) 0 0.07-0.83 (23, 53) Affective PBMC (1/3)33.3 (0/23) 0 (27) PBMC (1/6)16.7 (0/36) 0 (51) PBMC (0/9) 0 (56) Schizophrenia PBMC (7/11)63.6 (0/23) 0 (27) PBMC (5/49)10.2 (0/36) 0 (51) PBMC 4.2-9.3 (54) Brain (0/3) 0 (0/3) 0 (55) CSF (0/48) 0 (0/9) 0 (55) PBMC (0/9) 0 (0/9) 0 (55) PBMC (0/26) 0 (56) CFS PBMC (3/25) 12 6.0-14 (26) Hippocampal sclerosis Brain (4/5) 80 (53) --------------------------------------------------------------------------- Abbreviations: PBMC, peripheral blood mononuclear cells; CSF, cerebrospinal fluid; CFS, chronic fatigue syndrome. *Divergence of P-gene nucleotide sequence from common BDV isolates (strain V [4] and He/80 [9]). The earliest experiments in BDV molecular epidemiology examined whether conserved virus sequences could be identified across several host species. Reverse transcription polymerase chain reaction (RT-PCR), as well as extensive experimental passage through rabbit and rat brains and cell lines from various species, was used to amplify and clone coding and noncoding sequences from virus strains divergent by over 50 years' growth in nature. Because of inaccuracies in viral RNA-dependent RNA polymerases, most single-stranded RNA viruses have sequence divergence of 10 to the 3rd power to 10 to the 4th power per site per round of replication (48-50). Sequence analysis of BDV isolates showed a much lower rate of divergence. For N and P sequences, maximum variability was 4.1% at the nucleotide level and 1.5% at the predicted amino acid level (8). Similar sequence conservation was later found for sequences from naturally infected donkeys, sheep, and cats (9, H. Ludwig, pers. comm.). The extent to which sequence conservation in BDV represents enhanced polymerase fidelity, or more likely, selective environmental pressures is unknown. Extending molecular analysis to human materials is both complex and controversial. If BDV infects neuropsychiatric disease patients, viral nucleic acids are present at lower concentrations in human brain and PBMC than in previously studied naturally or experimentally infected hosts because investigators who report isolation of BDV nucleic acid from human PBMC must use the highly sensitive technique of nested RTPCR. Groups in Germany and Japan have detected viral nucleic acid in PBMC of patients with neuropsychiatric diseases: Bode and colleagues found BDV nucleic acids in four (66.7%) of six patients (22); Sauder and colleagues found BDV sequences in 13 (50%) of 26 neuropsychiatric patients (seven patients with schizophrenia, one with affective disorder, and five with other psychiatric disorders) (27); Kishi and co-workers found BDV nucleic acids in PBMC of 22 (37%) out of 60 neuropsychiatric patients (24) and eight (4.7%) out of 172 blood donor controls (25); Igata-Yi et al. detected BDV nucleic acids in six (10.9%) of 55 neuropsychiatric patients (five patients with schizophrenia, one with depression) versus zero of 36 blood donor controls (51); and Nakaya et al. reported BDV nucleic acid in three (12%) of 25 chronic fatigue syndrome patients (26). Additionally, BDV nucleic acids and immunoreactivity have been detected in the hippocampus of four of five North American patients with postmortem diagnosis of hippocampal sclerosis (52). Genomic analyses of BDV isolates from human patients have yielded differing estimates of nucleotide sequence conservation (Table 2). Extensive conservation of the N and P open reading frames, consistent with previous findings in field and tissue culture isolates (8), has been reported (22,27). Infectious BDV has been isolated after cocultivation of PBMC from neuropsychiatric patients with a human oligodendroglial cell line (23). Sequences of these isolates were highly conserved with previously identified sequences (53); other groups have described greater sequence divergence (26,54). However, differences in levels of sequence conservation may reflect variations in methods for RT-PCR amplification rather than true strain differences (27). In two reports RT-PCR did not yield evidence of BDV nucleic acid in neuropsychiatric disease patients (Table 2): No BDV nucleic acid was found by RT-PCR analysis of brain tissue, cerebrospinal fluid, or PBMC from patients with schizophrenia (55); similarly, no BDV nucleic acid was found in RT-PCR studies of PBMC from 26 patients with schizophrenia and nine with affective disorders (56). Special Considerations for BDV Diagnostics Although a wide variety of assays (IFA, Western immunoblot, radioimmunoprecipitation, and enzyme-linked immunosorbent assay) and antigen preparations (infected cells, infected cell extracts, and recombinant proteins produced in prokaryotic or baculovirus systems) have been used for BDV serology, generally accepted standards for diagnosis of human BDV infection have not been established. Because only limited data concerning interassay comparability for serology within individual laboratories (and none between different laboratories) have been established, discrepancies between investigators may reflect differences in clinical populations, assay sensitivity, or other factors. Similarly, agreement concerning methods for molecular diagnosis of BDV infection is limited. Most investigators use RT-PCR; some use a method sensitive to 100 to 300 copies of RNA template (nested RT-PCR, 80 to 100 cycles), while others use less sensitive methods (no nesting, 30 cycles). Only investigators using the more sensitive method have reported BDV gene products in human materials (PBMC, brain). RT-PCR, particularly nested RT-PCR, is prone to artifacts because of inadvertent introduction of template from laboratory isolates or cross-contamination of samples. Because putative human isolates detected by nested RT-PCR are similar in sequence to known animal and tissue culture isolates, it has been argued that they represent low-level contaminants. However, the finding of sequence conservation is consistent with previous analyses of well-characterized isolates disparate by host species and geography (8,9) and cannot be used to discount the validity of positive nested RT-PCR results. Future Directions The broad potential host range of BDV suggests that humans are targets for infection. Rodents with persistent BDV infection and minimal overt signs of disease and domestic animals and livestock could serve as vectors. Serum antibodies reactive with BDV have been detected in asymptomatic farmworkers exposed to ostriches with a Borna disease-like syndrome (57). Immunoreactivity to BDV and neurologic disturbances have been reported in a farm worker exposed to seropositive asymptomatic horses and sheep (58). Finally, although no human cases of disease have been linked to feline infection, there is evidence of BDV infection in house cats in Europe (59) and Japan (18). However, even though BDV could infect humans and is likely to do so, a number of questions remain unanswered: The sources and routes of potential human infection are not clear, no detailed epidemiology has been done in animal populations, and transmission from domestic animals to humans has not been demonstrated. Viral gene products are readily detected in CNS of natural and experimental hosts without such sensitive methods as nested RT-PCR. The need to use sensitive methods to detect BDV nucleic acid in humans indicates that the virus is present only at low levels. Thus, if BDV can be implicated as a factor in human neuropsychiatric disease, mechanisms for pathogenesis may be different from those found in other natural and experimental hosts. Although a higher prevalence of markers for BDV infection has been reported in neuropsychiatric patients than in controls, no single neuropsychiatric disease has been correlated with BDV infection. Efforts to link BDV with neuropsychiatric disease have not used accepted epidemiology standards. To rigorously address the issues of BDV epidemiology and pathogenesis, multicenter groups in Europe and the United States are collaborating to collect and perform blinded analysis of human clinical materials by standardized methods and reagents. The objectives of these projects will be to determine the prevalence of serum antibodies to BDV in patients and controls and the extent to which various assays for antibodies are in accord, the prevalence of BDV nucleic acids in brains and PBMC of patients and controls, and the correlation between antibodies to BDV or viral nucleic acids and a particular neuropsychiatric disease. Acknowledgments The Laboratory for Neurovirology is supported by a grant from the National Institutes of Health (NS29425), as well as awards from the Wayne and Gladys Valley Foundation, Cure Autism Now Foundation, and Lucille P. Markey Trust. Dr. Hatalski is a postdoctoral fellow in the Department of Anatomy & Neurobiology, University of California, Irvine, California, USA. Address for correspondence: W. Ian Lipkin, Laboratory for Neurovirology, Department of Neurology, University of California, Irvine, CA 92697-4290; fax: 714-824-1229; e-mail: ilipkin@uci.edu. References 1. de la Torre JC. Molecular biology of Borna disease virus: prototype of a new group of animal viruses. J Virol 1994;68:7669-75. 2. Schneemann A, Schneider PA, Lamb RA, Lipkin WI. The remarkable coding strategy of Borna disease virus: a new member of the nonsegmented negative strand RNA viruses. Virology 1995;210:1-8. 3. Briese T, de la Torre JC, Lewis A, Ludwig H, Lipkin WI. Borna disease virus, a negative-strand RNA virus, transcribes in the nucleus of infected cells. Proc Natl Acad Sci USA 1992;89:11486-9. 4. Briese T, Schneemann A, Lewis AJ, Park YS, Kim S, Ludwig H, Lipkin WI. Genomic organization of Borna disease virus. Proc Natl Acad Sci USA 1994;91:4362-6. 5. Schneemann A, Schneider PA, Kim S, Lipkin WI. Identification of signal sequences that control transcription of Borna disease virus, a nonsegmented negative-strand RNA virus. J Virol 1994;68:6514-22. 6. Cubitt B, Oldstone C, Valcarcel V, de la Torre JC. RNA splicing contributes to the generation of mature mRNAs of Borna disease virus, a non-segmented negative strand RNA virus. Virus Res 1994;34:69-79. 7. Schneider PA, Schneemann A, Lipkin WI. RNA splicing in Borna disease virus, a nonsegmented, negative-strand RNA virus. J Virol 1994;68:5007-12. 8. Schneider PA, Briese T, Zimmermann W, Ludwig H, Lipkin WI. Sequence conservation in field and experimental isolates of Borna disease virus. J Virol 1994;68:63-8. 9. Binz T, Lebelt J, Niemann H, Hagenau K. Sequence analyses of the p24 gene of Borna disease virus in naturally infected horse, donkey and sheep. Virus Res 1994;34:281-9. 10. Ludwig H, Bode L, Gosztonyi G. Borna disease: a persistent disease of the central nervous system. Prog Med Virol 1988;35:107-51. 11. Richt JA, VandeWoude S, Zink MC, Clements JE, Herzog S, Stitz L, et al. Infection with Borna disease virus: molecular and immunobiological characterization of the agent. Clin Inf Dis 1992;14:1240-50. 12. Solbrig MV, Fallon JH, Lipkin WI. Behavioral disturbances and pharmacology of Borna disease virus. Curr Top Microbiol Immunol 1995;190:93-102. 13. Narayan O, Herzog S, Frese K, Scheefers H, Rott R. Behavorial disease in rats caused by immunopathological responses to persistent Borna virus in the brain. Science 1983;220:1401-3. 14. Stitz L, Dietzschold B, Carbone KM. Immunopathogenesis of Borna disease. Curr Top Microbiol Immunol 1995;190:75-92. 15. Rott R, Becht H. Natural and experimental Borna disease in animals. Curr Top Microbiol Immunol 1995;190:17-30. 16. Kao M, Hamir AN, Rupprecht CE, Fu AF, Shankar V, Koprowski H, Dietzschold B. Detection of antibodies against Borna disease virus in sera and cerebrospinal fluid of horses in the USA. Vet Rec 1993;132:241-4. 17. Nakamura Y, Kishi M, Nakaya T, Asahi S, Tanaka H, Sentsui H, et al. Demonstration of Borna disease virus RNA in peripheral blood mononuclear cells from healthy horses in Japan. Vaccine 1995;13:1076-9. 18. Nakamura Y, Asahi S, Nakaya T, Bahmani MK, Saitoh S, Yasui K, et al. Demonstration of borna disease virus RNA in peripheral blood mononuclear cells derived from domestic cats in Japan. J Clin Microbiol 1996;34:188-91. 19. Gosztonyi G, Ludwig H. Borna disease-neuropathology and pathogenesis. Curr Top Microbiol Immunol 1995;190:39-73. 20. Morales JA, Herzog S, Kompter C, Frese K, Rott R. Axonal transport of Borna disease virus along olfactory pathways in spontaneously and experimentally infected rats. Med Microbiol Immunol 1988;177:51-68. 21. Bode L. Human infections with Borna disease virus and potential pathologic implications. Curr Top Microbiol Immunol 1995;190:103-30. 22. Bode L, Zimmermann W, Ferszt R, Steinbach F, Ludwig H. Borna disease virus genome transcribed and expressed in psychiatric patients. Nature Med 1995;1:232-6. 23. Bode L, Dürrwald R, Rantam FA, Ferszt R, Ludwig H. First isolates of infectious human Borna disease virus from patients with mood disorders. Mol Psychiatry 1996;1:200-12. 24. Kishi M, Nakaya T, Nakamura Y, Zhong Q, Ikeda K, Senjo M, et al. Demonstration of human Borna disease virus RNA in human peripheral blood mononuclear cells. FEBS Letters 1995;3645:293-7. 25. Kishi M, Nakaya T, Nakamura Y, Kakinuma M, Takahashi TA, Sekiguchi S, et al. Prevalence of Borna disease virus RNA in peripheral blood mononuclear cells from blood donors. Med Microbiol Immunol 1995;184:135-8. 26. Nakaya T, Takahashi H, Nakamura Y, Asahi S, Tobiume M, Kuratsune H, et al. Demonstration of Borna disease virus RNA in peripheral blood mononuclear cells derived from Japanese patients with chronic fatigue syndrome. FEBS Letters 1996;378:145-9. 27. Sauder C, Muller A, Cubitt B, Maer J, Steinmetz J, Trabert W, et al. Detection of Borna disease virus (BDV) antibodies and BDV RNA in psychiatric patients: evidence for high sequence conservation of human blood-derived BDV RNA. J Virol 1996;70:7713-24. 28. Sierra-Honigmann AM, Rubin SA, Estafanous MG, Yolken RH, Carbone KM. Borna disease virus in peripheral blood mononuclear and bone marrow cells of neonatally and chronically infected rats. J Neuroimmunol 1993;45:31-6. 29. Abildgaard PC. Pferde-und Vieharzt in einem kleinen Auszuge; oder, Handbuch von den gewöhnlichsten Krankheiten der Pferde, des Hornviehes, der Schafe und Schweine, sammt der bequemsten und wohl-feilesten Art sie zu heilen. Zum Gebrauch des Land-manns. Wien: Johann Thomas Edlen von Trattnern, 1785. 30. Carbone K, Duchala C, Griffin J, Kincaid A, Narayan O. Pathogenesis of Borna disease in rats: evidence that intra-axonal spread is the major route for virus dissemination and the determination for disease incubation. J Virol 1987;61:3431-40. 31. Solbrig MV, Koob GF, Joyce JN, Lipkin WI. A neural substrate of hyperactivity in Borna disease: changes in dopamine receptors. Virology 1996;222:332-8. 32. Dittrich W, Bode L, Ludwig H, Kao M, Schneider K. Learning deficiencies in Borna disease virus-infected but clinically healthy rats. Biol Psychiatry 1989;26:818-28. 33. Carbone K, Park S, Rubin S, Waltrip R, Vogelsang G. Borna disease: association with a maturation defect in the cellular immune response. J Virol 1991;65:6154-64. 34. Sprankel H, Richarz K, Ludwig H, Rott R. Behavior alterations in tree shrews induced by Borna disease virus. Med Microbiol Immunol 1978;165:1-18. 35. Stitz L, Krey H, Ludwig H. Borna disease in rhesus monkeys as a model for uveocerebral symptoms. J Med Virol 1980;6:333-40. 36. Rott R, Herzog S, Fleischer B, Winokur A, Amsterdam J, Dyson W, Koprowski H. Detection of serum anti-bodies to Borna disease virus in patients with psychiatric disorders. Science 1985;228:755-6. 37. Fu ZF, Amsterdam JD, Kao M, Shankar V, Koprowski H, Dietzschold B. Detection of Borna disease virus-reactive antibodies from patients with affective disorders by western immunoblot technique. J Affect Disord 1993;27:61-8. 38. Bode L, Ferszt R, Czech G. Borna disease virus infection and affective disorders in man. Arch Virol 1993;[Suppl] 7:159-67. 39. Bode L, Steinbach F, Ludwig H. A novel marker for Borna disease virus infection. Lancet 1994;343:297-8. 40. Bautista JR, Schwartz GJ, de la Torre JC, Moran TH, Carbone KM. Early and persistent abnormalities in rats with neonatally acquired Borna disease virus infection. Brain Res Bull 1994;34:31-40. 41. Bautista JR, Rubin SA, Moran TH, Schwartz GJ, Carbone KM. Developmental injury to the cerebellum following perinatal Borna disease virus infection. Brain Res Dev Brain Res 1995;90:45-53. 42. Yolken RH, Torrey EF. Viruses, schizophrenia, and bipolar disorder. Clin Microbiol Rev 1995;8:131-45. 43. Waltrip II RW, Buchanan RW, Summerfelt A, Breier A, Carpenter WT, Bryant NL, et al. Borna disease virus and schizophrenia. Psychiatry Res 1995;56:33-44. 44. Bechter K, Bauer M, Estler HC, Herzog S, Schuttler R, Rott R. Expanded nuclear magnetic resonance studies in Borna disease virus seropositive patients and control probands. Nervenarzt 1994;65:169-74. 45. Lipkin WI, Travis G, Carbone K, Wilson M. Isolation and characterization of Borna disease agent cDNA clones. Proc Natl Acad Sci USA 1990;87:4184-8. 46. VandeWoude S, Richt J, Zink M, Rott R, Narayan O, Clements J. A Borna virus cDNA encoding a protein recognized by antibodies in humans with behavioral diseases. Science 1990;250:1276-81. 47. Cubitt B, Oldstone C, de la Torre JC. Sequence and genome organization of Borna disease virus. J Virol 1994;68:1382-96. 48. Holland J, Spindler K, Horodyski F, Grabau E, Nichol S, VandePol S. Rapid evolution of RNA genomes. Science 1982;215:1577-85. 49. Holland JJ, de la Torre JC, Steinhauer DA. RNA virus populations as quasispecies. Curr Top Microbiol Im-munol 1992;176:1-20. 50. Morse SS. The evolutionary biology of viruses. New York: Raven, 1994. 51. Igata-Yi R, Kazunari Y, Yoshiki K, Takemoto S, Yamasaki H, Matsuoka M, Miyakawa T. Borna disease virus and consumption of raw horse meat. Nat Med 1996;2:948-9. 52. de la Torre JC, Gonzalez-Dunia D, Cubitt B, Mallory M, Mueller-Lantzsch N, Grasser F, et al. Detection of Borna disease virus antigen and RNA in human autopsy brain samples from neuropsychiatric patients. Virology 1996;223:272-82. 53. de la Torre JC, Bode L, Durrwald R, Cubitt B, Ludwig H. Sequence characterization of human Borna disease virus. Virus Res 1996;44:33-44. 54. Kishi M, Arimura Y, Ikuta K, Shoya Y, Lai PK, Kakinuma M. Sequence variability of Borna disease virus open reading frame II found in human peripheral blood mononuclear cells. J Virol 1996;70:635-40. 55. Sierra-Honigman AM, Carbone KM, Yolken RH. Polymerase chain reaction (PCR) search for viral nucleic acid sequences in schizophrenia. Br J Psychiatry 1995;166:55-60. 56. Richt JA, Alexander RC, Herzog S, Hooper DC, Kean R, Spitzen S, et al. Failure to associate human psychiatric disorders with Borna disease virus infection. In press. 57. Weisman Y, Huminer D, Malkinson M, Meir L, Kliche S, Lipkin WI, Pitlik S. Borna disease virus antibodies among workers exposed to infected ostriches. Lancet 1994;344:1232-3. 58. Bechter K, Schüttler R, Herzog S. Case of neurological and behavioral abnormalities: due to Borna disease virus encephalitis? Psychiatry Res 1992;42:193-6. 59. Lundgren A-L, Czech G, Bode L, Ludwig H. Natural Borna disease in domestic animals other than horses and sheep. J Vet Med 1993;40:298-303. 60. Bode L, Riegel S, Ludwig H, Amsterdam J, Lange W, Koprowski H. Borna disease virus-specific antibodies in patients with HIV Infection and with mental disorders. Lancet 1988;ii:689. 61. Rott R, Herzog S, Bechter K, Frese K. Borna disease, a possible hazard for man. Arch Virol 1991;118:143-9. 62. Amsterdam J, Winokur A, Dyson W, Herzog S, Gonzalez F, Rott R, Koprowski H. Borna Disease Virus: a possible etiologic factor in human affective disorders. Arch Gen Psychiatry 1985;42:1093-6. 63. Bode L, Riegel S, Lange W, Ludwig H. Human infections with Borna disease virus: seroprevalence in patients with chronic diseases and healthy individuals. J Med Virol 1992;36:309-15. --------------------------------------------------------------------------- [Emerging Infectious Diseases * Volume 3 * Number 2 * April-June 1997] Synopses The Rickettsia: an Emerging Group of Pathogens in Fish John L. Fryer and Michael J. Mauel Oregon State University, Corvallis, Oregon, USA --------------------------------------------------------------------------- Piscirickettsia salmonis is the first of the previously unrecognized rickettsial pathogens of fish to be fully characterized. Since the recognition of P. salmonis in 1989, the impact of rickettsial pathogens in fish has become increasingly apparent. Growing awareness of the emergence of these fastidious intracellular organisms has led to the discovery of rickettsial diseases among diverse species of fish from different geographic locations and aquatic environments. The source, reservoir, and mode of transmission of these agents as well as appropriate methods of disease prevention and control remain to be established. The Emergence of Rickettsial Diseases in Fish The earliest report of a rickettsialike organism in fish occurred in 1939 during examination of diseased Tetrodon fahaka from the Nile River in Egypt. The microorganisms were observed within stained tissue cells, but no attempts were made to culture them (1). In 1975 Ozel and Schwanz-Pfitzner (2) first cultured rickettsialike organisms from fish while examining rainbow trout (Oncorhynchus mykiss) for Egtved virus. While cultivating the virus in RTG-2 cells (3), they observed that cells also contained an intracellular rickettsialike organism. However, research on the organism was limited, and its taxonomic position and relevance to disease were not determined. The microorganism was not maintained and is no longer available for evaluation. No further reports of rickettsia in fish appeared until 1986 when Davies observed rickettsialike organisms in the tissue of dragonets (Callionymus lyra L.) collected in waters off the coast of Wales (4) (Table 1). The role of rickettsiae as emerging pathogens of fish became apparent in 1989 (5), when a previously unrecognized bacterium (6) was isolated in the chinook salmon (Oncorhynchus tshawytscha) embryo cell line, CHSE-214 (7) and was demonstrated to be the cause of epizootics in marine-netpen-reared coho salmon species and (Oncorhynchus kisutch) in Region X, Chile (8). Table 1. Unidentified rickettsialike organisms observed in and/or isolated from fish --------------------------------------------------------------------------- Fish host Geo. Salt/Fresh Obs./ Ref. species location Water Iso. --------------------------------------------------------------------------- Fokaka Egypt F(a) O(c) 1 (Tetrodon fahaka) Rainbow trout Europe F I(d) 2 (Oncorhynchus mykiss) Dragonet Wales S(b) O 5 (Callionymus lyra) Masu salmon Chile S O (Oncorhynchus masou)(e) Mozambique tilapia Taiwan S & F I 15 (Oreochromis mossambicus) Nile tilapia (O. niloticus) Blue tilapia (O. aureus) Redbelly tilapia (Tilapia zillii) Wami tilapia (T. hornorum) Blue-eyed plecostomus Colombia F O 16 (Panaque suttoni) Atlantic salmon Chile F I 19 (Salmo salar) Sea bass France S O 17 (Dicentrarchus labrax) --------------------------------------------------------------------------- (a)F = Host collected from fresh water (b)S = Host collected from salt water (c)O = Observed only (d)I = Isolated in cell culture (e)Sandra Bravo, Puerto Montt, Chile Piscirickettsia salmonis, was the first rickettsialike organism isolated from fish, characterized, and demonstrated to cause disease in experimentally infected hosts (6). Initially, rickettsial infections of fish were thought to be confined to coho salmon in southern Chile, but the agent and the disease it causes have since been observed in other locations (Table 2). In British Columbia, Brocklebank et al. (9,10) observed that sea-farmed Atlantic salmon (Salmo salar) also manifested pathologic features indistinguishable from those of salmonids in Chile. The causation of the disease was established by experimental infection followed by isolation in CHSE-214 cells. The organism was morphologically similar to P. salmonis, but comparatively less virulent for salmonids. These researchers also provided anecdotal reports that the same condition occurred as early as 1970 in pink salmon (Oncorhynchus gorbuscha) held in sea water tanks in British Columbia; beginning in the 1980s, the condition was also seen in coho and chinook salmon from local sea farms rearing salmonids. Rickettsiae morphologically similar to those implicated in the diseases in Chile and Canada also caused low level mortality in Atlantic salmon held in sea water cages in Norway (11) and Ireland (12). We have identified all of these agents as P. salmonis by direct fluorescence antibody tests using the polyclonal antiserum (unpub. data; 13). Until 1994, all recognized rickettsial diseases of fish had been observed in species of salmonids cultured in sea water. However, it is now apparent that these pathogens affect fish over a broad host and geographic range and in both fresh water and marine environments. Chern and Chao (14) reported an epizootic rickettsial disease in several species of tilapia in both marine and fresh water ponds in Taiwan (Table 1). Death rates associated with this disease reached 95% at certain sites. Khoo et al. (15) reported a rickettsialike organism in moribund specimens of a fresh water tropical fish, the blue-eyed plecostomus (Panaque suttoni), shipped to the United States from Colombia. In France, Comps et al. (16) found rickettsialike organisms in the brain of moribund juvenile seabass (Dicentrarchu labrax) exhibiting abnormal swimming behavior and in Chile, Gaggero et al. (17) isolated P. salmonis from diseased coho salmon and rainbow trout held only in fresh water. A different, and as yet unidentified, bacterium has been isolated in fish cell cultures from diseased Atlantic salmon in Chile that had been reared only in fresh water. Table 2. Piscirickettsia salmonis LF-89(T) observed in and/or isolated from fish --------------------------------------------------------------------------- Fish Salt Host Geo. Fresh Obs./ Species Location Water Iso. Ref. --------------------------------------------------------------------------- Coho salmon Chile S(a) I(c) 6 (Oncorhynchus kisutch) Rainbow trout Chile S O/I(d) 9 (Oncorhynchus mykiss) Chinook salmon (Oncorhynchus tshawytscha) Atlantic salmon (Salmo salar) Chinook salmon British S O/I 11 Columbia Atlantic salmon Canada Coho salmon Pink salmon (Oncorhynchus gorbuscha) Atlantic salmon Ireland S O(e) 13 Atlantic salmon Norway S O/I 12 Coho salmon Chile F(b) I 18 Rainbow trout --------------------------------------------------------------------------- (a) S = Host fish collected from salt water (b) F = Host fish collected from fresh water (c) I = Isolated in cell culture The organism is smaller than P. salmonis, ca. 0.2-0.8 vs. ca. 0.5-1.5 in diameter, and both are usually coccoidal in shape. The unidentified bacterium was intracellular in spleen and kidney, did not grow on several types of bacteriologic media, and reportedly did not react with polyclonal antibodies against P. salmonis (18). The rickettsialike organisms observed in and/or isolated from nonsalmonid fish have not been characterized sufficiently to determine their relationship to P. salmonis. Taxonomic placement of these agents requires additional study. Neorickettsia helminthoeca, the cause of the "salmon poisoning" disease of canids, is associated with fish but is not a fish pathogen. It is carried by the digenetic trematode, Nanophyetus salmincola, a parasite of salmonid fish in the Pacific Northwest (19). N. helminthoeca has been cultured in canine and murine cells but does not grow in cells of salmonid fish (20). Phylogenetically, N. helminthoeca is more closely related to the ehrlichiae and the rickettsia than it is to P. salmonis based on an analysis using the April 3, 1997, 16S rRNA gene sequence database containing 6,000 sequences. In addition, when P. salmonis was tested with N. helminthoeca antiserum by indirect immunofluorescence, no reaction was observed (6). There is no indication that P. salmonis or other rickettsial pathogens of fish cause disease in humans or other warm blooded animals. We speculate that the optimum temperature of 15°C to 18°C with no growth at 25°C and above prevents P. salmonis from becoming established in warm-blooded animals. P. salmonis Taxonomic Position P. salmonis is the best characterized of the rickettsiae observed in and/or isolated from fish. The type species LF-89(T) was isolated from a diseased coho salmon from a sea water netpen site in southern Chile during an epizootic. The organism has been placed in a new genus in the order Rickettsiales, family Rickettsiaceae based primarily on their similar morphology and obligate intracellular nature (6). It has been deposited with the American Type Culture Collection as ATCC VR 1361. Many rickettsiae observed in or isolated from fish since 1989 have been identified serologically as P. salmonis (Table 2). We tested isolates from coho salmon and rainbow trout from Chile and from Atlantic salmon reared in Chile; British Columbia, Canada; and Norway. All five isolates are morphologically similar to LF-89(T) and react with polyclonal antibodies against the type strain. Certain monoclonal antibodies developed in our laboratory can differentiate between these isolates (unpub. data). The 16S ribosomal DNA of these five isolates from three geographic locations were amplified by PCR to assess the genetic variability in this species or species-complex. The PCR products were sequenced and compared with other bacterial small subunit rRNA sequences. The genus Piscirickettsia belongs within the gamma subdivision of the proteobacteria and is not closely related to species of Erlichiae, Rickettsia, or Neorickettsia from the subdivision of alpha proteobacteria (Figure 1). The similarities between Piscirickettsia, Ehrlichiae, and Rickettsia species are approximately 80%. Similarities between Piscirickettsia, Coxiella, and Wolbachia are approximately 86% to 88%. The five P. salmonis isolates form a tight monophyletic cluster with relatedness of 99.7% to 98.5%. Two of the isolates from Chile and those from Norwegian and Canadian fish are closely related (>99.4% similarity). One isolate from Chile, EM-90, differed from the other four isolates (21). Similarity values for EM-90 were 98.5% to 98.9%. [Figure 1] [Figures not available in ASCII version] 2% divergence Figure 1. Phylogenetic relationships of Piscirickettsia salmonis, selected rickettsiae and bacteria. Evolutionary distances were calculated by the method of Jukes and Cantor (34). After eliminating regions of ambiguity and uncertain homology 1,313 positions of the 16S rDNA gene were compared. To further clarify the genetic variability in this genus, the internal transcribed spacer (ITS) and 23S rDNA of six isolates have been analyzed. One spacer sequence was identified per isolate, and the region did not contain a tRNA gene. The ITS sequences were 311-bp in length and varied among the isolates (95.2% to 99.7% similarity). Only one ITS sequence was obtained for each of the P. salmonis isolates, suggesting the presence of one rRNA operon, which agrees with reports for other slow growing organisms (22). Approximately 1,900-bp of the 23S rDNA gene have been analyzed for the six isolates, and similarities ranged from 97.9% to 99.8%. Three Chilean isolates and the Norwegian and Canadian isolates are closely related (99.1% to 99.7% ITS and 99.3% to 99.8% 23S rDNA similarities). The sequence of isolate EM-90 differed from those of the other five isolates (similarities ranged from 95.2% to 96.9% ITS and 97.6% to 98.5% 23S rDNA). Phylogenetic trees constructed with the 16S, ITS, and 23S rDNA data showed similar topography, further reinforcing the relationships indicated between the isolates. Comparison of the P. salmonis ITS with the 16S rDNA region shows that it has diverged on average 3.15 times faster than the 16S rDNA gene, while the 23S rDNA gene has diverged 1.6 times faster than the 16S rDNA gene. This is similar to findings with other obligate intracellular bacteria (23). Characteristics of the Type Strain LF-89(T) P. salmonis, type strain LF-89(T) is a nonmotile, gram-negative, obligatedly intracellular bacterium. It is predominately coccoid (ca. 0.5-1.5 mm in diameter) and also occurs as rings or pairs of curved rods (Figure 2). It replicates within membrane-bound cytoplasmic vacuoles (Figure 3) in selected fish cells lines and in the cells of tissues throughout infected fish. Thin sections of the bacterium examined by electron microscopy display typical gram-negative cell walls and the protoplasmic structure of a prokaryote. Giemsa stains the rickettsiae cells dark blue. LF-89(T) does not react with the monoclonal antibody made against the group-specific chlamydial LPS antigen (5). [Image] [Figures not available in ASCII version] Figure 2. Piscirickettsia salmonis within a cytoplasmic vacuole in CHSE-214 cell line 4 days post inoculation. Note organisms dividing within vacuole. May Greenwald-Giemsa stain. Bar = 1 µm. [Image] [Figures not available in ASCII version] Figure 3. Piscirickettsia salmonis undergoing apparent binary fission within a vacuole in the cytoplasm of infected CHSE-214 cells. Bar = 10 µm. P. salmonis can be cultivated in certain fish cell lines where it produces a cytopathic effect. It does not replicate on any known cell-free media, and its in vitro growth characteristics have been described (6). Replication is optimal at 15°C to 18°C, retarded above 20°C and below 10°C, and does not occur above 25°C. It replicates to titers of 10 to the 6th power to 10 to the 7th power TCID50 ml to the -lth power in fish cell cultures. Titers are decreased 99% or more by a single cycle of freeze-thaw at -70°C. The addition of 10% DMSO to the freezing medium acts as a cryopreservative. In vitro, it is sensitive to a broad range of antibiotics. Tenfold dilutions of spent medium from an LF-89(T)infected cell culture injected into groups of 40 juvenile coho salmon and groups of 30 juvenile Atlantic salmon resulted in death rates of 88% to 100% during a 42-day experiment (8). Typical signs of the disease were present in the inoculated experimental coho, whereas in Atlantic salmon, the only gross sign of disease was death. The LD50 was not obtained, but death in both species followed a dose-response pattern, and LF-89(T) was reisolated from each group inoculated. Extracellular survival of LF-89(T) was tested under selected environmental conditions (24); infectivity remained for at least 14 days in preparations of semipurified LF-89(T) suspended in high salinity sea water at 5°C, 10°C, and 15°C. Infectivity was rapidly reduced in preparations suspended in fresh water. Titers dropped below the level of detection [10 to the 2th power TCID(subscript 50)/ml] immediately after suspension in fresh water, and no infectious material could be recovered from these preparations. Piscirickettsiosis P. salmonis produces an epizootic disease of fish called piscirickettsiosis. Death rates associated with piscirickettsiosis in salmonids range from a high of 90% among coho in Chile (25) to a low of 0.06% in Canada and Norway (9,11). All species of salmonids cultured in Chile are affected by this disease, but the highest death rates occur in coho salmon cultured in salt water. Fish in sea water netpens begin to die 6 to 12 weeks after their transfer from fresh water (5). Deaths peak in the fall and rise again the following spring (26). A variety of clinical signs are associated with P. salmonis infection, but few are specific to piscirickettsiosis. Moribund fish collect at the water surface along the edges of the sea cages; they are lethargic, dark, and show loss of appetite (9); the gills are pale, and hematocrits are frequently 25% or less. The first signs observed are often hemorrhages and lesions of the skin. The lesions range from small areas to shallow ulcers up to 2 cm in diameter (25). Internally, the kidney is swollen and the spleen enlarged. Petechial hemorrhages are found on the swim bladder and viscera. Diagnostic ringshaped, cream-colored lesions are present on the livers of chronically infected fish (Figure 4). In acute cases, death may be the only gross sign of disease (27). The histopathologic symptoms associated with P. salmonis infection and the disease it causes have been described, but a great deal of work remains to be done (25-27). Piscirickettsiosis produces marked pathologic changes in most internal organs of infected fish, where severe changes occur in the intestine, kidney, liver, and spleen. Necrosis and inflammation may occur throughout the body, especially in cells adjacent to blood vessels. Epithelial hyperplasia results in lamellar fusion of the gills. The bacterium is commonly observed within macrophages and in the cytoplasm of infected host cells. [Figure 4] [Figures not available in ASCII version] Figure 4. Coho salmon infected with Piscirickettsia salmonis. Note cream- colored lesions on liver, enlarged spleen, pale gills, and hemorrhaged areas within the peritoneal cavity. Mode of Transmission The source, reservoir, and means of transmission of P. salmonis continue to be important areas of study. Although piscirickettsiosis has been observed in salmonid fish over a widespread geographic area (Table 2), with the exception of the predictable annual epizootics in Chile, the infections seem sporadic and of limited virulence in other parts of the world. No association other than the marine environment and the host species is apparent between locations in Canada, Norway, and Ireland. One or more naturally occurring aquatic animals, perhaps only transiently present, may provide the source and reservoir of these rickettsiae in the widely separated diverse areas. No alternate host has been identified. P. salmonis has been experimentally passed by injection (8,26), but the normal mode of transmission for this agent (horizontal, vertical, or through a vector) has not been demonstrated. Except in Coxiella burnetii, an intermediate host or vector is required for transmission of rickettsiae in the terrestrial environment (28). C. burnetii not only has an intermediate host but appears to develop a sporogenic phase that protects it from drying when it is host or vector free. No vector or sporogenic phase has been observed for P. salmonis. P. salmonis may not require an intermediate host or sporogenic stage for survival and transmission in the aquatic environment. The extended extracellular survival time of this organism in salt water (24) may be of sufficient duration to permit horizontal transmission without a vector. The almost immediate deactivation of the rickettsia in fresh water makes direct horizontal transmission unlikely unless P. salmonis was protected by host(s) cell membranes or tissue exudates. Limited research designed to demonstrate the role of horizontal transmission has provided mixed results. Garcés et al. (8) saw no evidence of horizontal transmission between injected coho salmon dying of piscirickettsiosis and uninjected salmon held in a cage in the same tank of flowing fresh water. Cvitanich et al. (26) reported horizontal transmission between injected and sham-injected coho salmon held in static fresh and sea water aquaria. Environmental conditions differed between experiments (e.g., flowing water at a mean temperature of 10.5°C vs. static water at 15°C), therefore, meaningful comparisons could not be made. Nevertheless, this research suggests that under certain circumstances, horizontal transmission is possible. Although rickettsiae are found in the gonads of infected fish, vertical transmission of P. salmonis has not been demonstrated. The limited number of piscirickettsiosis cases reported in fresh water indicate that vertical transmission is, at best, rare. Until definitive studies are conducted, the questions of source, reservoir, and normal mode of transmission of P. salmonis remain unanswered. Detection and Identification Inoculation of susceptible fish cell lines is the most sensitive method for detecting P. salmonis (29). However, isolation of an infectious agent sensitive to low levels of antibiotics routinely used in cell culture presents a problem. All cultures must be maintained in antibiotic-free medium. Diagnostic specimens collected aseptically in the field may become contaminated by other bacteria. For this reason, preliminary diagnosis of piscirickettsiosis is normally made by examining Gram, Giemsa, methylene blue, or acridine orange-stained kidney imprints or smears, and confirming their identity by serologic methods, e.g., immunofluorescence (13) or immunohistochemistry (30). A nested polymerase chain reaction (PCR) using universal 16S rDNA bacterial outer primers and P. salmonis-specific internal primers was developed to detect the genomic DNA. The nested PCR assay allowed detection of less than one P. salmonis tissue culture infectious dose 50 (TCID50). Using the P. salmonis-specific primers in a single amplification allowed detection of 60 TCID50. The specificity of PCR was assessed with a panel of four salmonid and 15 bacterial genomic DNA preparations. Products derived from amplification were observed only from P. salmonis DNA (31). Restriction fragment length polymorphism analysis of the 16S rDNA products from six isolates of P. salmonis demonstrated that one isolate, EM-90, was different. Two additional primers were developed that differentiate EM-90 from the other five P. salmonis isolates (31). PCR using DNA extracted from spleens of tilapia or paraffin-embedded tissue of the blue-eyed plecostomus did not produce amplification products. These tissues were collected and examined from fish during an epizootic caused by rickettsialike organism (unpub. data). Amplification using 16S rDNA universal primers was successful, which suggests that the rickettsialike organism infecting these fish were not P. salmonis. Control of the Disease Although P. salmonis is sensitive in vitro to many of the antibiotics commonly used to control other infectious diseases of fish, e.g., tetracycline, erythromycin, and oxolinic acid (6,26), these preparations have not been useful in treating fish with piscirickettsiosis. Antibiotic levels may not reach sufficient concentrations within the host cells in vivo, to terminate replication of the pathogen. The lack of effective methods for treating piscirickettsiosis has encouraged the development of disease prevention techniques. Vaccines have been successfully used for control of certain gram-negative bacterial diseases of fish; however, at present no efficacious preparations have been developed to protect fish against P. salmonis. Questions remain concerning P. salmonis and the disease it causes in fish. The reservoir(s) of the infectious agent should be determined if the spread of the disease is to be controlled (32). There is a need to determine the mode(s) of transmission of P. salmonis to fully understand the pathogenesis of piscirickettsiosis. The infectivity of P. salmonis for native, nonsalmonid fish has not been investigated. Difference in virulence between P. salmonis in Chile and salmonids in the Northern Hemisphere is an important consideration. It must be determined if intrinsic differences in the isolates, the host fish, the environment, or some combination of factors is responsible for these differences. The rickettsiae from salmonid fish in the fresh water and marine environments should be compared, and the relationships between the rickettsiae from salmonid fish and those from other fish species should be determined. A new group of fish pathogens was recognized in 1989 with the isolation and identification of P. salmonis LF-89T from cultured salmonids in Chile (5,6). The rickettsial etiology of an infectious disease of fish in a variety of locations and host species suggests that they are an important group of emerging fish pathogens (33). These pathogens have caused severe mortality among cultured salmonids in Chile and are not present among stocks of important food fish cultured in British Columbia, Canada, Norway, and Ireland. Taiwan has experienced serious losses amon talapia, another important food fish. At least one species imported for aquaria are also infected with a rickettsialike agent. The lack of antimicrobial drugs and vaccines for prevention and control emphasize the need for additional research. The method of transmission of P. salmonis is not understood and needs to be researched. The movement of fish and spread of the agent make the develoment of improved diagnostic techniques important. Acknowledgments We thank Dr. Sandra Bravo of Puerto Montt, Chile, for the photograph of a diseased fish in Figure 4. Preparation of this paper was supported in part by the Oregon Sea Grant with funds from the National Oceanic and Atmospheric Administration Office of Sea Grant, Department of Commerce, under grant NA36RG0451, project R/FSD-22. This is Oregon Agricultural Experiment Station Technical Paper Number 11,090. Dr. Fryer has been a faculty member of the Department of Microbiology at Oregon State University (OSU) for more than 35 years, serving as chair for 20 of those years. His research has focused primarily on the infectious diseases of Pacific salmon and other species of fish. He is professor emeritus and director of the Center for Salmon Disease Research at OSU. Dr. Mauel received his degree from the Department of Microbiology at Oregon State University in 1996 and is a postdoctoral fellow at the Center for Vector-borne Disease, University of Rhode Island. His scientific interests concern the molecular biology of fastidious intracellular pathogenic bacteria. Address for correspondence: John L. Fryer, 220 Nash Hall, Department of Microbiology, Oregon State University, Corvallis, OR 97331-3804, USA; fax: 541-737-2166; e-mail: fryerj@bcc.orst.edu. References 1. Mohamed Z. The discovery of a rickettsia in a fish. Ministry Agriculture Cairo, Technical Science Service, Veterinary Section Bulletin 1939;214:1-6. 2. Ozel M, Schwanz-Pfitzner I. Vergleichende elektronenmikroskopische Untersuchungen an Rhabdoviren pflanzlicher und tierischer Herkunft: III. Egtved-Virus (VHS) der Regenbogenforelle (Salmo gairdneri) und Rickettsienahnliche Organismen. Zentralblatt fuerr Bakteriologie Mikrobiologie und Hygiene, I Abt Originale A 1975;230:1-14. 3. Wolf K, Quimby MC. Established eurythermic line of fish cells in vitro. Science 1962;135:1065-66. 4. Davies AJ. A rickettsia-like organism from dragonets, Callionymus lyra L. (Teleostei: Callionymidae) in Wales. Bulletin of the European Association of Fish Pathologists 1986;6:103. 5. Fryer JL, Lannan CN, Garcès LH, Larenas JJ, Smith PA. Isolation of a rickettsiales-like organism from diseased coho salmon Oncorhynchus kisutch in Chile. Fish Pathology 1990;25(2):107-14. 6. Fryer JL, Lannan CN, Giovannoni SJ, Wood ND. Piscirickettsia salmonis gen. nov., sp. nov., the causative agent of an epizootic disease in salmonid fishes. Int J Syst Bacteriol 1992;42:120-6. 7. Lannan CN, Winton JR, Fryer JL. Fish cell lines: establishment and characterization of nine cell lines from salmonids. In Vitro 1984;20:671-6. 8. Garcés LH, Larenas JJ, Smith PA, Sandino S, Lannan CN, Fryer JL. Infectivity of a rickettsia isolated from coho salmon (Oncorhynchus kisutch). Diseases of Aquatic Organisms 1991;11:93-7. 9. Brocklebank JR, Speare DJ, Armstrong RD, Evelyn T. Septicemia suspected to be caused by a rickettsia-like agent in farmed Atlantic salmon. Can Vet J 1992;33:407-8. 10. Evelyn TPT. Salmonid rickettsial septicemia. In: Kent ML, editor) Diseases of seawater netpen-reared salmonid fishes in the Pacific Northwest. Canadian special Publication Fish Aquatic Science 116. Nanaimo (BC): Department Fisheries and Oceans 1992;18-9. 11. Olsen AB, Evensen Ø, Speilberg L, Melby HP, Håstein T. <> laksesykdom forårsaket av rickettsie. Norsk Fiskeoppdrett NR 1993;12:40-1. 12. Rodger HD, Drinan EM. Observation of a rickettsia-like organism in Atlantic salmon, Salmo salar L., in Ireland. J Fish Dis 1993;16:361-9. 13. Lannan CN, Ewing SA, Fryer JL. A fluorescent antibody test for detection of the rickettsia causing disease in Chilean salmonids. Journal of Aquat Animal Health 1991;3:229-34. 14. Chern RS, Chao CB. Outbreaks of a disease caused by a rickettsia-like organism in cultured tilapias in Taiwan. Fish Pathology 1994;29:61-71. 15. Khoo L, Dennis PM, Lewbart GA. Rickettsia-like organisms in the blue-eyed plecostomus, Panaque suttoni (Eigenmann & Eigenmann). Journal of Fish Diseases 1995;18:157-64. 16. Comps M, Raymond JC, Plassiart GN. Rickettsia-like organism infecting juvenile sea-bass Dicentrarchus labrax. Bulletin of the European Association of Fish Pathologists 1996;16:30-3. 17. Gaggero A, Castro H, Sandino AM. First isolation of Piscirickettsia salmonis from coho salmon, Oncorhynchus kisutch (Walbaum), and rainbow trout, Oncorhynchus mykiss (Walbaum), during the freshwater stage of their life cycle. Journal of Fish Diseases 1995;18:277-9. 18. Cvitanich JD, Garate NO, Silva PC, Andrade VM, Figueroa PC, Smith CE. Isolation of a new rickettsia-like organism from Atlantic salmon in Chile. AFS/FHS Newsletter 1995;23:1-3. 19. Milleman RE, Knapp SE. Biology of Nanophyetus salmincola and "salmon poisoning" disease. Adv Parasitol 1970;8:1-41. 20. Noonan WE. Neorickettsia helminthoeca in cell culture (dissertation). Corvallis (OR): Oregon State University, 1973. 21. Mauel MJ. Evidence for molecular diversity of Piscirickettsia salmonis (dissertation). Corvallis (OR): Oregon State University, 1996. 22. Frothingham R, Wilson KH. Sequence-based differentiation of strains in the Mycobacterium avium complex. J Bacteriol 1993;175:2818-25. 23. Stothard DR, Clark JB, Furst PA. Ancestral divergence of Rickettsia bellii from the spotted fever and typhus groups of Rickettsia and antiquity of the genus Rickettsia. Int J Syst Bacteriol 1994;44:798-804. 24. Lannan CN, Fryer JL. Extracellular survival of Piscirickettsia salmonis. Journal of Fish Diseases 1994;17:545-8. 25. Branson EJ, Nieto Diaz-Munoz D. Description of a new disease condition occurring in farmed coho salmon, Oncorhynchus kisutch (Walbaum), in South America. Journal of Fish Diseases 1991;14:147-56. 26. Cvitanich JD, Garate NO, Smith CE. The isolation of a rickettsia-like organism causing disease and mortality in Chilean salmonids and its confirmation by Koch's postulate. Journal of Fish Diseases 1991;14:121-45. 27. Larenas HJ, Hidalgo VL, Garcés AH, Fryer JL, Smith SP. Piscirickettsiosis: lesiones en salmón del Atlántico (Salmo salar) infectados naturalmente con Piscirickettsia salmonis. Avances en Ciencias Veterinarias 1995;10:53-8. 28. Weiss E, Moulder JW. Order I. Rickettsiales Gieszczkiewicz 1939, 25(AL), In: Krieg NR, editor. Bergey's Manual of Systematic Bacteriology, Vol. 1. London: Williams and Wilkins, 1984:687-729. 29. Lannan CN, Fryer JL. Recommended methods for inspection of fish for the salmonid rickettsia. Bulletin of the European Association of Fish Pathologists 1991;11:135-6. 30. Alday-Sanz V, Rodger H, Turnbull T, Adams A, Richards RH. An immunohistochemical diagnostic test for rickettsial disease. Journal of Fish Diseases 1994;17:189-91. 31. Mauel MJ, Giovannoni SJ, Fryer JL. Development of polymerase chain reaction assays for detection, identification, and differentiation of Piscirickettsia salmonis. Diseases of Aquatic Organisms 1996;26:189-95. 32. Fryer JL, Lannan CN. Rickettsial and chlamydial infections of freshwater and marine fishes, bivalves, and crustaceans. Zoological Studies 1994;33:95-107. (Translated into Japanese by Professor Tokuo Sano and appears in Fish. Res. 1995; 14(3):54-65.) 33. Fryer JL, Lannan CN. Rickettsial infections of fish. Annual Review of Fish Diseases 1996. In press. 34. Jukes TH, Cantor CR. Evolution of protein molecules. In: Munro HN, editor. Mammalian protein metabolism. New York: Academic Press Inc., 1996:21-132. --------------------------------------------------------------------------- [Emerging Infectious Diseases * Volume 3 * Number 2 * April-June 1997] Synopses Rhodococcus equi and Arcanobacterium haemolyticum: Two "Coryneform" Bacteria Increasingly Recognized as Agents of Human Infection Regina Linder Hunter College, New York, New York, USA --------------------------------------------------------------------------- Rhodococcus equi and Arcanobacterium haemolyticum, formerly classified in the genus Corynebacterium, are members of the loosely defined taxon "coryneform" bacteria. Although they are the etiologic agents of distinct human infections, both organisms are frequently overlooked, which results in missed or delayed diagnoses. R. equi, long known as an important pathogen of immature horses, has become in the past three decades an opportunistic pathogen of severely immunosuppressed humans. Most cases are secondary to HIV infection. When specifically sought in throat swab cultures, A. haemolyticum is found responsible for 0.5% to 2.5% of bacterial pharyngitis, especially among adolescents. These two microorganisms represent a spectrum of disease in humans: from a mild, common illness to a rare life-threatening infection. Each organism elaborates lipid hydrolyzing enzymes (cholesterol oxidase by R. equi and sphingomyelinase D by A. haemolyticum) that are toxic to animals and humans and damaging to mammalian cell membranes. The participation of the cytotoxins in pathogenicity is discussed. Greater awareness of the properties of these two bacteria may promote faster, more accurate diagnoses and better clinical management. A variety of factors contribute to the underreporting of human infections caused by bacteria in the genus Corynebacterium and closely related genera. The group, often referred to as "coryneform," comprises taxonomically diverse gram-positive rods resembling Corynebacterium diphtheriae and displaying pleomorphism and irregular cellular arrangements (1,2). The group includes human and animal pathogens, as well as commensal bacteria. The control of diphtheria in industrialized countries and the subsequent deemphasis of the genus Corynebacterium have contributed to discounting isolates characteristic of the genus as contaminants. Even reference laboratories report difficulty in the speciation of gram-positive pleomorphic rods that resemble corynebacteria (1). Because of the emergence of a number of coryneform bacteria as important human pathogens, rigorous biochemical and molecular tools have increasingly been applied to isolates. The resulting improved epidemiology and taxonomy have led, for example, to the definition of CDC groups JK and D-2 in the genus Corynebacterium, now recognized as important opportunistic pathogens (1). Similarly, more accurate characterization of some species caused them to be removed from the genus Corynebacterium. Excellent reviews of the pathogenicity and epidemiology of these diverse genera have been published (1,2). This article explores two pathogenic coryneform bacteria: Rhodococcus equi, a rare often fatal human pathogen, in which virtually all human infections occur among compromised hosts; and Arcanobacterium haemolyticum, which is responsible for many respiratory infections in healthy people. This article aims to bring about improved recognition of these two easily overlooked pathogens and considers mechanisms underlying the diseases, the immune response of the hosts, and treatment protocols. Eidemiology and Clinical Presentation R. equi Originally isolated by Magnusson in 1923 from granulomatous lung infections in young horses (3), Corynebacterium (now Rhodococcus equi) remains an important pathogen of foals. Much of the considerable body of knowledge about R. equi, including its pathogenicity and immune response to infection, derives from veterinary studies and has been recently updated (4). R. equi is readily found in soil, especially where domesticated livestock graze (5). The stool of horses and other animals is the source of soil contamination. Infection in humans derives from environmental exposure (2,5), and the organism may be ubiquitous in soil (6). While early cases occurred mostly in persons with a history of contact with horses, only 20% to 30% of recent cases can be traced to such contact (7). A review of cases in the three decades since the first reported human infection in 1967 is presented in Table 1. Table 1. Rhodococcus equi case reports in humans: 1967-1996 ------------------------------------------------------------------------- Primary site of Predisposing condition infection Years Cases (number) (number) Deaths References(a) ------------------------------------------------------------------------- 1967-76 7 Corticosteroid (1) Lung (6) 0 8-10 Cancer/immunosuppressant Lymphatic (3) (1) Renal transplant (2) None(b)(1) 1977-86 15 Corticosteroid (1) Lung (14) 8 8-10,22 Cancer/immunosuppressant (4) Blood (1) Renal transplant (2) HIV (7) Alcoholism (1) 1987-96 93 Cancer/immunosuppressant Lung (72) 34 8-13,22 (8) Renal transplant (3) Lymphatic (2) HIV (67) Blood (8) Other(c) (8) (1(b)) Wound (6) None (7) (4(b)) Other(d) (5) ------------------------------------------------------------------------- (a)In the interest of space, case compilations are cited in lieu of individual case reports. (b)Child (c)Includes intravenous drug use, lab infection, emphysema, kidney disease. (d)Central nervous system, gastrointestinal R. equi is a rare opportunistic pathogen found in severely compromised patients, and most commonly in recent years, in human immunodeficiency virus (HIV)-infected persons. Early cases, most in patients receiving immunosuppressant therapy, were more likely to be successfully treated with antimicrobial agents than cases in AIDS patients (8). Most often, patients have a slowly progressive granulomatous pneumonia, with lobar infiltrates, frequently developing to cavitating lesions visible on chest x-ray. Other sites of infection include abscesses of the central nervous system, pelvis, and subcutaneous tissue, and lymphadenitis (7,8-10). Cases of lung infection caused by inhalation and cutaneous lesions caused by wound contamination have been documented; the latter are almost the only R. equi infections reported in healthy persons, frequently children (11). Delays in accurate diagnosis of R. equi are still common (2,7), despite increased awareness of this organism as an opportunistic pathogen in humans. Factors for delayed diagnosis include the insidious onset of disease, clinical resemblance of the infection to mycobacterial, fungal, and actinomycotic infections, and the relatively nondescript bacteriologic profile of R. equi. Morphology, partial acid fastness, and a distinctive histopathologic profile in bronchial specimens (Figure 1 A and B) contribute to accurate diagnosis. Numerous polymorphonuclear leukocytes with intracellular pleomorphic gram-positive bacteria, microabscesses, pseudotumors, and malakoplakia are noted on tissue (7,11). Malakoplakia is a relatively rare granulomatous inflammation not typically associated with histology of lung infection and can be of help in forming a differential diagnosis (11,12). Firm diagnosis and differentiation from similar pathogens require the isolation and identification of R. equi from sputum, bronchial washings, open-lung biopsy, or other specimens reflective of pathology. Blood cultures from severely immunosuppressed patients with focal R. equi infection often contain the organism. In sixty-five percent of cases secondary to HIV infection, the organism is found in patients' blood cultures (11). Deaths exceed 50% among AIDS patients with documented R. equi pneumonia and are almost always preceded by multiple relapses, which are common even when successful treatment is ultimately achieved (Table 1; 13). A[Figure 1A] [Figures not available in ASCII version] B[Figure 1B] [Figures not available in ASCII version] Figure 1. A. Bronchial tissue Gram stain showing intrahistiocytic coccobacillary forms of Rhodococcus equi. Original magnification, x 1,000. B.Open lung biopsy showing coalescent microabscesses with numerous histiocytes containing Rhodococcus equi organisms. PAS stain. Original magnification x 250. Figure provided by Dr. Margie Scott, Vanderbilt University Medical Center. Corynebacterium haemolyticum A. haemolyticum was first described and named by MacClean et al. (14), who isolated it from pharyngeal infections in U.S. soldiers and natives in the South Pacific. Classification of the organism generated controversy until the definition in 1982 of a new genus, Arcanobacterium (secretive bacterium), in which it remains the only species (15). Unlike R. equi infection, where invasive clinical disease underscores the need to detect and identify the causative agent of infection, A. haemolyticum infection is often reported from deliberate screening for the organism of a large number of patients with sore throats. After it was identified during World War II from patients with pharyngitis (14), it was occasionally reported from Europe, the United States, and in 1981, Sri Lanka (16 cases) (16). Most cases involve pharyngitis and/or tonsillitis, and approximately 50% are exudative. Throat infections are often accompanied by cervical lymphadenopathy (17,18). Diagnosis of cases (distinct from screening studies) often occurs only after recurrent infections, which are thought to be related to incorrect initial diagnosis, resulting in less-than-optimum treatment (19). Infection is most common in 15- to 25-year-old persons, and is thought to result from droplet transfer from infected persons (20). Symptoms resemble those of ß-hemolytic streptococci or viral infection. The spectrum of disease ranges from sore throat to, in rare cases, a life-threatening membranous pharyngitis resembling diphtheria (18,20). An erythematous morbilliform or scarlatinal rash of the trunk, neck, or extremities is associated with 20% to 25% of cases (19), enhancing the possibility of misdiagnosis as streptococcal infection or penicillin allergy, because ß-lactam therapy is frequently initiated without accurate diagnosis. A recent report describes in detail the dermatologic manifestations of A. haemolyticum infection (20). The demonstration that A. haemolyticum is not a component of the human commensal flora was essential to establishing its role in human infection. Studies of more than 2,000 cases each found the organism only in association with clinical symptoms (17,19). Table 2 summarizes several case compilations, including the incidence of infection among culture-positive bacterial sore throats, as well as data on coinfection. Some 0.5% to 3% of cases of pharyngitis can be traced to A. haemolyticum depending on the population studied, with the highest numbers among 15- to 30-year-old patients (19). Clearly, accurate diagnosis depends on differentiating A. haemolyticum from more common pathogens. A. haemolyticum occurs relatively often in polymicrobic infections together with typical respiratory pathogens such as streptococci. The isolation of classical pathogens from specimens that also contain A. haemolyticum exacerbates the tendency to overlook the organism. Table 2. Representative pharyngitis screenings for Arcanobacterium haemolyticum --------------------------------------------------------------------------- Period of Clinical study Number of Incidence(a) features (reference) isolations Rash Coinfection (%) (population) --------------------------------------------------------------------------- 1978-80 (16) 16 0 13 (C. NR Symptomatic diphtheriae, throat S. pyogenes, E. swabs and coli, pyoderma (Sri P. aeruginosa) Lanka) 1981-85 (19) 81(b) 37 NR 2.0 Symptomatic throat swabs (Sweden) 1990-92 (17) 42 17 NR 0.36 Symptomatic throat swabs; 5 cases onospot positive (Ottawa, Canada) 1991-92 (42) 19 5 11 0.49 Symptomatic (streptococci, throat swabs, groups A, B, G) 3922(c); (Finland) 1992-95 (43) 16 12 5 (streptococci, 0.75 Symptomatic groups A, B, throat swabs, ß-hemolytic) 2121(c); (Czech Republic) --------------------------------------------------------------------------- NR-not reported (a) Incidence refers to the proportion of sore throat cases in each study cited yielding A. haemolyticum. (b)1 of 550 asymptomatic specimens yielded A. haemolyticum. (c)Figures refer to the total specimens screened. Taxonomy, Bacteriology, and Differential Identification R. equi On the basis of the chain length of mycolic acids and other properties of its lipids, R. equi was reclassified in the suprageneric taxon nocardioform actinomycetes (1,2,5). R. equi is a strictly aerobic gram-positive bacterium displaying rod-to-coccus pleomorphism, with fragmenting and occasionally palisading forms. It is nonfastidious. Colonies on blood agar from clinical specimens can be mucoid and coalescing. Typical salmon pink pigmentation develops on blood agar, but often only after 2 to 3 days incubation. Growth on Lowenstein-Jensen medium allows earlier detection of pigment (M. Scott, pers. comm.). Positive routine biochemical tests include catalase and urease, but R. equi is generally nonreactive. Acid-fast staining of direct smears and fresh isolates is helpful in identification but is rarely observed on subculture (5,7). Some diagnostic laboratories use a commercial kit (API Coryne strip (bioMerieux-Vitek, Hazelwood, MO) for identification. Also helpful in identifying R. equi is synergistic hemolysis (resembling the CAMP test), displayed by cross-streaking on sheep blood agar with any of a number of other bacteria, including A. haemolyticum, Staphylococcus aureus, and Corynebacterium pseudotuberculosis (21; Figure 2). Synergistic hemolysis is discussed among mechanisms of pathogenesis (below). In addition, antagonism between imipenem and other ß-lactam antibiotics used against strains of R. equi provides the opportunity of differentiating the organism from taxonomically related species (22). [Figure] [Figures not available in ASCII version] Figure 2. Cooperative (and antagonistic) hemolytic reactions on sheep blood agar, demonstrating cooperative hemolysis between Rhodococcus equi, Arcanobacterium haemolyticum, and Staphylococcus aureus. Partial hemolysis by S. aureus (cross-hatched on diagram) is inhibited in the proximity of A. haemolyticum. A. haemolyticum Organisms are gram-positive rods—slender at first, sometimes clubbed, or in angular arrangements. Coccal forms predominate as the organism grows. The organism is facultatively anerobic. Growth is enhanced in blood and in the presence of CO2. Some sugars are fermented, and the organism is catalase negative. Hemolysis is best observed on human blood, and Gaston et al. (20) suggest routine plating of specimens suspected of containing A. haemolyticum on human blood agar to distinguish Streptococcus pyogenes. Pitting beneath colonies on human blood agar is helpful in identification. Synergistic hemolysis with R. equi (or inhibition of the hemolytic zone of S. aureus, (Figure 2) is useful in identification, especially as it may rule out group B streptococci. Poor growth on tellurite assists in differentiation from Corynebacterium diphtheriae. Pathogenesis and the Immune Response R. equi Because R. equi is a rare and recently emergent cause of human infection, mechanisms of its pathogenicity are not well defined. However, the much-studied infection in foals and an experimental model in mice provide data which, together with the available human data, give insight into the workings of the pathogen. Its nature as a facultatively intracellular bacterium, able to persist, grow, and ultimately destroy macrophages (23-25), is the property of R. equi most closely associated with virulence in each host. Foal alveolar macrophages having ingested R. equi did not undergo phagosome-lysosome fusion and were irreversibly damaged in electron micrographs (26). Results of pathology tests (microscopy and roentgenography) reflect significant inflammation, consistent with that found in such other intracellular pathogens as Mycobacterium tuberculosis, which elude pulmonary clearance. Open lung biopsies in humans show numerous polymorphonuclear leukocytes, foam cells, and cavitating lesions with intracellular bacteria (7,11; Figure 1). Also as in mycobacteria, cell wall mycolic acids are present. These acids may contribute to the ability of R. equi to grow in macrophages; virulence of strains for mice was found related to the carbon chain length of the molecules (27). Granuloma formation was observed when killed R. equi strains, regardless of virulence, were introduced into inbred mice, supporting a role for mycolic acids or other cell wall glycolipids in pulmonary inflammation (28). A key contributor to virulence in the foal and the mouse model is a group of large (85-90 kb) plasmids, encoding 15-17 kDa antigens among strains isolated from almost all natural infections in foals (29). Strains cured of the plasmid are cleared in experimental infections, and intracellular replication in murine macrophages is greatly diminished in its absence (25,28). In contrast, of 39 strains isolated from humans (29 with AIDS), 31 strains did not express the virulence associated plasmid and were non-virulent in mice (6). The investigators suggest that intracellular growth and, therefore, virulence among human strains may not be explained by the same determinants as foals, while mycolic acids may play a role. Nordmann (23) found that intracellular growth in mouse and human macrophages of strains isolated from AIDS patients was related to ß-lactam resistance, the production of a bacteriophage, and virulence in inbred mice. Virulence was not attributable to 17kDa virulence antigens, but soluble cytotoxic substances were associated with the virulent phenotype. The cytotoxic activity remains to be characterized, and its relationship to known cytotoxic activities of R. equi remains to be elucidated. In addition to numerous hydrolytic enzymes typical of the genus Rhodococcus (5), strains of R. equi, irrespective of virulence, produce cholesterol oxidase, which is responsible for the organism's participation in synergistic hemolytic reactions with other bacteria (30; Figure 2). Experiments using cultured mouse macrophages with phagocytosed R. equi suggest a role for cholesterol oxidase in macrophage destruction in infections. Macrophages undergo oxidation of membrane cholesterol, and the accumulation of oxidized cholesterol is significantly enhanced by the cophagocytosis of C. pseudotuberculosis, a related coryneform bacterium producing sphinomyelinase D (31). Toxicity to vertebrates as a result of enzymatic oxidation of membrane cholesterol is documented in diverse systems, most dramatically by lethality to hypercholesterolemic rabbits (31). Because R. equi is uniquely an opportunistic pathogen in humans, it is of interest to consider the precise nature of the immune deficiency that underlies susceptibility to this organism. Recent investigations in immunodeficient mice are especially instructive. T-cell subsets, specifically functional CD4+ lymphocytes, are necessary to effect complete clearance of R. equi challenge (23,32). Specifically, Kanaly et al. showed that CD4+ Th1 cells (expressing interferon-gamma) are sufficient to achieve clearance from the lungs of mice (32,33). Consistent with these data, peripheral mononuclear cells, from patients with AIDS, challenged in vitro with R. equi failed to secrete high levels of interferon-gamma in comparison with cells from healthy donors (34). Investigations implicating a specific defect in the Th1 phenotype in the pathogenicity of AIDS make these studies especially provocative and suggest a role for immunotherapy in R. equi infection (33). While cell-mediated immunity appears to have a primary role in protecting against R. equi infection, the participation of humoral antibody has been established in foals. Passive immunization with hyperimmune serum is efficacious in prophylaxis, and severity of disease is inversely related to circulating antibody (1,5). Mastroianni et al. (35) demonstrated antibody to the major antigens of R. equi in four AIDS patients with cavitating pneumonia. The role of such antibody in the natural history of the infection remains to be elucidated. A. haemolyticum Little is known about the mechanisms by which A. haemolyticum produces infection or brings about the skin manifestations frequently associated with it. The organism is known to produce uncharacterized hemolytic agent(s) (20) and two biochemically defined extracellular products: a neuraminidase and a phospholipase D (PLD) acting preferentially on sphingomyelin and generating ceramide phosphate in the target membrane (36). Of these, PLD is known to bring about tissue damage, as elaborated by this organism as well as the closely related bacterium, C. pseudotuberculosis, an important pathogen of sheep. Soucek et al. (36) found that the enzyme was responsible for the dermonecrotic, as well as the synergistic hemolytic, activity of the organisms that elaborate it. The PLD gene from A. haemolyticum has been cloned and shown to have a high degree of homology with that of C. pseudotuberculosis, where it is thought to participate in vascular permeability and dissemination of the pathogen (37). Evidence relates PLD with toxicity of C. pseudotuberculosis. Targeted mutagenesis of the PLD gene of C. pseudotuberculosis confirmed the role of the enzyme in virulence and specifically in dissemination in the host (38). Mutant bacteria had a reduced ability to establish infection in goats and were unable to disseminate by the lymphatics to secondary sites. A PLD sharing many properties with corynebacterial PLDs, including biochemical and biological activities, is responsible for the toxicity of the venom of the brown recluse spider (39). The role of potentiated cytotoxicity caused by the combined activity of PLD and cooperative agents such as cholesterol oxidase in disease is not established, but suggested by in vitro data involving cophagocytosis as described above (31). Treatment R. equi Increased recognition of R. equi as a cause of life-threatening infection in severely immunocompromised persons has promoted a number of studies of in vitro antimicrobial susceptibility of clinical isolates (11,13,40,41). While variations exist, most strains were susceptible to inhibition by glycopeptide antibiotics (including vancomycin and teicoplanin) and rifampin. Macrolide antibiotics, such as erythromycin and clarithromycin, were also inhibitory to many strains. Resistance to ß-lactam antibiotics (with the exception of carbapenems, specifically imipenem) was generally reported, and is not related to the production of a ß-lactamase. Because of relapse in spite of treatment in a majority of cases (11) and high mortality rate, especially among AIDS patients (Table 1), there is no standard treatment protocol for pulmonary and/or systemic R. equi infections. However, several principles reflect the accumulated experience of investigators. Careful and repeated culture and susceptibility testing during treatment is required to discover acquired resistance, in a manner similar to the treatment of mycobacterial infection (11,22). Tolerance to the cidal effects of some drugs and the need for long-term therapy (generally 2 months to life-long treatment; 40,41) make bactericidal testing a useful addition to laboratory studies. In consideration of the severe immunosuppression of patients and proclivity to relapse, investigators generally promote a combination of at least two drugs parenterally (usually including a glycopeptide or rifampin) followed by oral maintenance therapy (11,41). Recommendation of lipophilic antimicrobials that penetrate macrophages is controversial (11,41). A proposed regimen involves parenteral glycopeptide plus imipenem for at least 3 weeks, followed by an oral combination of rifampin, plus either macrolides or tetracycline (41). Examples of efficacious protocols for parenteral treatment are available (Table 1). Surgical lung resection has been reported occasionally since the emergence of human cases, especially where large focal lesions develop (9,10), and has sometimes been efficacious in combination with antimicrobial therapy. As cases of R. equi continue to be recognized among AIDS patients, antimicrobial prophylaxis against this opportunistic pathogen may prove a benefit. A. haemolyticum In vitro testing of A. haemolyticum isolated from human infections shows susceptibility to erythromycin, gentamicin, clindamycin, and cephalosporins (42). Reports of treatment failure with penicillin in spite of low minimum inhibitory concentrations have been attributed to tolerance and to failure to penetrate the intracellular location of the pathogen. Erythromycin has been proposed as the drug of choice, with parenteral antimicrobial drugs used for serious infections (20). The general similarity of the susceptibility pattern of A. haemolyticum to more commonly encountered pharyngeal pathogens, including S. pyogenes, makes culture and accurate diagnosis essential if cases are to be recognized for their true etiology. Its participation in polymicrobic infections (Table 2) requires that A. haemolyticum be specifically sought in appropriate specimens to obtain accurate diagnosis and to allow epidemiologic analysis. R. equi and A. haemolyticum represent distinct poles of infectious disease: one a ubiquitous soil organism producing life-threatening opportunistic infections and the other a readily treatable respiratory infection of healthy young persons. In both instances, a high degree of suspicion is required to make accurate and timely diagnoses of infections. Diagnostic failure may result in a graver clinical profile including deaths for R. equi and, in many undiagnosed or misdiagnosed cases, for A. haemolyticum. As members of the morphologically defined taxon "coryneform" bacteria, these organisms exemplify properties of the group that require further elucidation. Weakly pathogenic and noninvasive, the group includes environmental bacteria; animal pathogens "crossing-over" to become human opportunistic pathogens; commensals similarly infecting compromised hosts; and producers of a wide variety of hydrolytic enzymes bearing a poorly defined relation to virulence (1). Both R. equi and A. haemolyticum elaborate a cytotoxic protein (cholesterol oxidase or sphingomyelinase D) known to be responsible for systemic harm to animals. Coincidentally, these products potentiate each other's cytotoxic action. The participation of the agents in harm to a host, alone or in combination with other substances, is consistent with available data, but yet unproven. Of particular interest is the role of cholesterol oxidase in destruction of alveolar macrophages in R. equi pneumonia. Clarifying the role of synergistic or cooperative cytotoxins in one or more infectious diseases will surely improve our understanding of others because of the common occurrence of these agents among bacterial pathogens (21). It is difficult to envision the potentiated hemolytic combination of R. equi and A. haemolyticum at the site of an infectious lesion. However, cooperatively hemolytic combinations have been shown to result from the partnership of hydrolytic enzymes (e.g., phospholipases, which are ubiquitous in tissue) with the cytotoxins of pathogenic bacteria (10). Similarly, the hydrolytic enzymes of commensal bacteria or copathogens that occur, for example, in A. haemolyticum pharyngitis, can readily be envisioned to participate in potentiated cytotoxicity in host tissue. Together with improved recognition of these two pathogens, greater understanding of their toxic products should prove beneficial. Acknowledgments I am grateful to Dr. Margie Scott for providing additional information on her cases and the micrographs in Figure 1. I thank Dr. Alan Bernheimer for his critical review of the manuscript and Dr. Patrice Nordmann for helpful discussions. Dr. Linder is associate professor of health sciences at Hunter College, City University of New York, and director of the Medical Laboratory Sciences Program, which prepares undergraduates for careers in laboratory medicine. Her research involves the mechanisms of action and role of bacterial cytotoxins in infection. Address for correspondence: Regina Linder, School of Health Sciences, Hunter College, 425 East 25th St., New York, NY 10010, USA;fax:212-420-9135;e-mail:rlinder@shiva.hunter.cuny.edu. References 1. Coyle MB, Lipsky BA. Coryneform bacteria in infectious diseases: clinical and laboratory aspects. Clin Microbiol Rev 1990;3:227-46. 2. McNeil MM, Brown JM. The medically important aerobic actinomycetes: epidemiology and microbiology. Clin Microbiol Rev 1994;7:357-417. 3. Magnusson H. Spezifische infektioese Pneumonie beim Fohlen. Ein neuer Eitererreger beim Pferd. Archiv fur Wissenschaftliche und Praktische Tierheilkunde 1923;50:22-37. 4. Prescott JF, Holmes MA, Yager JA, Takai S, editors. Rhodococcus equi and immunology of the foal. Vet Microbiol. In press. 5. Prescott, JF. Rhodococcus equi: an animal and human pathogen. Clin Microbiol Rev 1991;4:20-34. 6. Takai S, Sasaki Y, Ikeda T, Uchida Y, Tsubaki S, Sekizaki T. Virulence of Rhodococcus equi isolates from patients with and without AIDS. J Clin Microbiol 1994;32:457-60. 7. Scott MA, Graham BS, Verall R, Dixon R, Schaffner W, Tham KT. Rhodococcus equi-an increasingly recognized opportunistic pathogen. Am J Clin Pathol 1995;103:649-55. 8. Doig C, Gill MJ, Church DL. Rhodococcus equi-an easily missed opportunistic pathogen. Scand J Infect Dis 1991;23:1-6. 9. Harvey RL, Sunstrum JC. Rhodococcus equi infection in patients with and without human immunodeficiency virus infection. Reviews of Infectious Diseases 1991;13:139-45. 10. Linder R. Rhodococcus equi: an emerging opportunist in humans. PHLS Microbiology Digest 1994;11:87-91. 11. Verville TD, Huycke MM, Greenfiled RA, Fine DP, Kuhls TL, Slater LN. Rhodococcus equi infections in humans. Medicine 1994;73:119-32. 12. Sutor GC, Fibich C, Kirschner P, Kuske M, Schmidt RE, Schedel I, Deicher H. Poststenotic cavitating pneumonia due to Rhodococcus equi in HIV infection. AIDS 1996;10:339-40. 13. Donisi A, Suardi MG, Casari S, Longo M, Cadeo GP, Carosi G. Rhodococcus equi infection in HIV-infected patients. AIDS 1996;10;359-62. 14. MacLean PD, Liebow AA, Rosenberg AA. A hemolytic corynebacterium resembling Corynebacterium ovis and Corynebacterium pyogenes in man. J Infect Dis 1946;79:69-90. 15. Collins MD, Jones D, Schofield GM. Reclassification of Corynebacterium haemolyticum in the genus Arcanobacterium gen. nov. as Arcanobacterium haemolyticum nom.rev.,comb.nov. Journal of General Microbiology 1982;128:1279-81. 16. Wickremesinghe RSB. Corynebacterium haemolyticum infections in Sri Lanka. Journal of Hygiene-Cambridge 1981;87:271-7. 17. Mackenzie A, Fuite LA, Chan FTH, King J, Allen A, MacDonald N, Diaz-Mitoma F. Incidence and pathogenicity of Arcanobacterium haemolyticum during a 2-year study in Ottawa. Clin Infect Dis 1995;21:177-81. 18. Green SL, LaPeter KS. Pseudodiphtheritic membranous pharyngitis caused by Corynebacterium hemolyticum. JAMA 1981;2330-1. 19. Banck G, Nyman M. Tonsilitis and rash associated with Corynebacterium haemolyticum. J Infect Dis 1986;154:1037-40. 20. Gaston DA, Zurowski SM. Arcanobacterium haemolyticum pharyngitis exanthem. Arch Dermatol 1996;132:61-4. 21. Fraser G. The effect on animal erythrocytes of combinations of diffusible substances produced by bacteria. J Pathol Bacteriol 1964;88:43-58. 22. Nordmann P, Nicolas MH, Gutmann L. Penicillin-binding proteins of Rhodococcus equi: potential role in resistance to imipenem. Antimicrob Agents Chemother 1993;37:1406-9. 23. Nordmann P, Zinzendorf N, Keller M, Lair I, Ronco E, Guenounou M. Interaction of virulent and non-virulent Rhodococcus equi human isolates with phagocytes, fibroblast- and epithelial-derived cells. FEMS Immunol Med Microbiol 1994;9:199-206. 24. Hietala SK, Ardans AA. Interaction of Rhodococcus equi with phagocytic cells from R. equi-exposed and non-exposed foals. Vet Microbiol 1987;14:307-20. 25. Hondalus MK, Mosser DM. Survival and replication of Rhodococcus equi in macrophages. Infect Immun 1994;62:4167-75. 26. Zink MC, Yager JA, Prescott JF, Fernando MA. Electron microscopic investigation of intracellular events after ingestion of Rhodococcus equi by foal alveolar macrophages. Vet Microbiol 1987;14:295-305. 27. Gotoh K, Mitsuyama M, Imaizumi S, Yano I. Mycolic acid-containing glycolipid as a possible virulence factor of Rhodococcus equi for mice. Microbiol Immunol 1991;35:175-85. 28. Takai S, Madarame H, Matsumoto C, Inoue M, Sasaki Y, Hasegawa Y, et al. Pathogenesis of Rhodococcus equi infection in mice: roles of virulence plasmids and granulomagenic activity of bacteria. FEMS Immunol Med Microbiol 1995;11:181-90. 29. Tkachuk-Saad O, Prescott J. Rhodococcus equi plasmids: isolation and partial characterization. J Clin Microbiol 1991;29:2696-2700. 30. Linder R, Bernheimer AW. Enzymatic oxidation of membrane cholesterol in relation to lysis of sheep erythrocytes by corynebacterial enzymes. Arch Biochem Biophys 1982;213:395-404. 31. Linder R, Bernheimer AW. Cytotoxicity of Rhodococcus equi related to generation of cholestenone in macrophage and erythrocyte membranes. Vet Microbiol. In press. 32. Kanaly ST, Hines SA, Palmer GH. Transfer of a CD4+ Th1 cell line to nude mice effects clearance of Rhodococcus equi from the lung. Infect Immun 1996;64:1126-32. 33. Kanaly ST, Hines SA, Palmer GH. Cytokine modulation alters pulmonary clearance of Rhodococcus equi and development of granulomatous pneumonia. Infect Immun 1995;63:3037-41. 34. Delia S, Mastroianni CM, Lichtener M, Mengoni F, Moretti S, Vullo V. Defective production of interferon-gamma and tumour necrosis factor-alpha by AIDS mononuclear cells after in vitro exposure to Rhodo-coccus equi. Mediators of Inflammation 1995:4:306-9. 35. Mastroianni CM, Lichtner M, Vullo V, Delia S. Humoral immune response to Rhodococcus equi in AIDS patients with R. equi pneumonia. J Infect Dis 1994;169:1179-80. 36. Soucek A, Michalec C, Souckova A. Identification and characterization of a new enzyme of the group "phospholipase D" isolated from Corynebacterium ovis. Biochim Biophys Acta 1971;227:116-28. 37. Cuevas WA, Songer JG. Arcanobacterium haemolyticum phospholipase D is genetically and functionally similar to Corynebacterium pseudotuberculosis phospholipase D. Infect Immun 1993;61:4310-6. 38. McNamara PJ, Bradley GA, Songer JG. Targetted mutagenesis of the phospholipase D gene results in decreased virulence of Corynebacterium pseudotu-berculosis. Mol Microbiol 1994;12:921-30. 39. Bernheimer AW, Campbell BJ, Forrester LJ. Com-parative toxinology of Loxosceles reclusa and Corynebacterium pseudotuberculosis. Science 1985;228:590-1. 40. McNeil MM, Brown JM. Distribution and antimicrobial susceptibility of Rhodococcus equi from clinical specimens. Eur J Epidemiol 1992;8:437-43. 41. Nordmann P. Antimicrobial susceptibility of human isolates of Rhodococcus equi. Medical Microbiology Letters 1995;4:277-86. 42. Carlson P, Renoken OV, Kotainen S. Arcanobacterium haemolyticum and streptococcal pharyngitis. Scand J Infect Dis 1994;26:283-7. 43. Chalupa P, Jezek P, Jurankova J, Sevcikova A. Isolation of Arcanobacterium haemolyticum from throat culture samples in the Czech Republic. Infection 1995;23:397. --------------------------------------------------------------------------- [Emerging Infectious Diseases * Volume 3 * Number 2 * April-June 1997] Synopses Is Creutzfeldt-Jakob Disease Transmitted in Blood? Maura N. Ricketts,* Neil R. Cashman,† Elizabeth E. Stratton,* Susie ElSaadany* *Laboratory Centre for Disease Control, Health Canada, Ottawa, Ontario, Canada; and †Montreal Neurological Institute, Montreal, Canada --------------------------------------------------------------------------- Creutzfeldt-Jakob disease (CJD) has been considered infectious since the mid-1960s, but its transmissibility through the transfusion of blood or blood products is controversial. The causative agent's novel undefined nature and resistance to standard decontamination, the absence of a screening test, and the recognition that even rare cases of transmission may be unacceptable have led to the revision of policies and procedures worldwide affecting all facets of blood product manufacturing from blood collection to transfusion. We reviewed current evidence that CJD is transmitted through blood. Creutzfeldt-Jakob disease (CJD), a rare neurodegenerative disorder, affects 0.5 to 1 persons per million population worldwide each year (1-8). CJD is a human spongiform encephalopathy; others are kuru, which is associated with ritualistic cannibalism in the Fore tribe of Papua New Guinea; Gerstmann-Sträussler-Scheinker syndrome, an inherited disorder; and fatal familial insomnia, inherited as an autosomal-dominant trait. Animal spongiform encephalopathies include scrapie, bovine spongiform encephalopathy (BSE), transmissible mink encephalopathy, and wasting disease of elk most frequently referred to as transmissible spongiform encephalopathies; other names such as prion dementias, transmissible degenerative encephalopathies, and infectious cerebral amyloidoses are also used. The classic clinical symptoms of CJD are rapidly progressive presenile dementia, myoclonus, and progressive motor dysfunction. No treatment is available, and survival averages less than 1 year (most often 2 to 6 months) (9). Diagnosis is based on symptoms, electroencephalograms, and neuropathologic tests (10,11). The pathophysiology of CJD is incompletely understood, although it is known that in persons with the disease, the normal soluble prion protein (PrPC) is conformationally shifted into a more stable, less soluble ß-pleated protein. The term PrPCJD indicates the abnormal isoform found, with a variety of distribution patterns in the brain of persons with CJD. Limited proteolysis of PrPCJD by Western blot analysis shows four patterns of protease-resistant prion protein (12,13). No screening assay is available to detect PrP in asymptomatic persons. Cerebrospinal fluid protein markers can distinguish CJD from other neurodegenerative disorders in certain settings (14,15). However, they are not CJD-specific and are not markers of PrP. The etiologic agent is believed to be a prion (proteinaceous infectious particle), although viral etiologies have been proposed (16-18). Sporadic CJD may also result from the spontaneous conversion of PrPC into PrPCJD or from somatic mutation in the prion protein gene. Three epidemiologic forms of CJD are well recognized: sporadic (the most common), familial, and infectious/iatrogenic. The familial form (5% to 10% of cases) results from mutations in the coding sequence of the PrP gene located on chromosome 20. Polymorphisms at codon 129 have been correlated with genetic susceptibility to human prion diseases (19). Fewer than 1% of human cases of CJD are iatrogenic (20). A new variant (nv-CJD), which occurred temporally in association with BSE in cattle in the United Kingdom, was recently reported (21); a direct association with food consumption remains uncertain. Possible transmission of CJD through receipt of blood or blood products is a concern. Routes of iatrogenic transmission are summarized below, followed by a discussion of possible bloodborne transmission. Iatrogenic CJD Although first described in the 1920s, CJD was not considered a transmissible disease until 1966 when kuru was shown to be transmissible (22). In 1968, CJD was confirmed to be a transmissible spongiform encephalopathy when it was shown to be transmitted to chimpanzees (23). Virtually every case of CJD attributed to infection is iatrogenic; transmission between humans has been clearly demonstrated during neurosurgical procedures with contaminated instruments and through central nervous system tissue and extract transfer. Worldwide, more than 100 cases of transmissible CJD have been detected, and new cases continue to appear (Table 1; 27). Table 1. Transmissible cases of Creutzfeldt-Jakob Disease ------------------------------------------------------------------- Mode of infection No. Agent entry Mean incubation of patients into brain period (range) ------------------------------------------------------------------- INSTRUMENTATION Neurosurgery 4 Intracerebral 20 months (15-28) Stereotactic EEG 2 Intracerebral 18 months (16-20) TISSURE TRANSFER Corneal transplant 2 Optic nerve 17 months (16-18) Dura mater implant 25 Cerebral surface 5.5 years (1.5-12)) TISSURE EXTRACT TRANSFER Growth hormone 76 Hematogenous 12 years (5-30) Gonadotrophin 4 Hematogenous 13 years (12-16) ------------------------------------------------------------------- EEG = electroencephalogram Table taken from (27) The first report of suspected iatrogenic CJD was published in 1974 (24). Animal experiments showed that corneas of infected animals could transmit CJD, and the causative agent spreads along visual pathways (25,26). A second case of CJD associated with a corneal transplant was reported without details (27). In 1977, CJD transmission caused by silver electrodes previously used in the brain of a person with CJD was first reported (28). Transmission occurred despite decontamination of the electrodes (later shown to transmit disease to experimental primates [29]) with ethanol and formaldehyde. Retrospective studies identified four other cases likely of similar cause (30-32). The rate of transmission from a single contaminated instrument is unknown, although it is not 100% (31). In some cases the exposure occurred weeks after the instruments were used on a person with CJD. CJD was first reported in a recipient of a dura mater transplant in 1987 (33); a second case was identified in 1989 in a 25-year-old man from New Zealand, who also received dura mater (34). Because the same company produced dura mater for both patients, the dura mater was suspected as the source of iatrogenic CJD. Approximately 15 case reports have been published, providing information on 20 cases associated with dura mater transplant; a recent review article indicates that 25 such cases have occurred throughout the world (Australia, Canada, Germany, Italy, Japan, New Zealand, Spain, the United Kingdom, and the United States) (27). However, Japan has very recently reported more than 40 cases of CJD in dura mater recipients (J. Tateishi, Pers. Comm.). Most dura mater cases have been associated with a single manufacturer whose manufacturing processes were inadequate to inactivate the prion agent. This, combined with pooling of the dura mater has led to the relatively large number of cases. The earliest reported transmission occurred in a patient who received a dura mater transplant in 1969 (35). Although recommendations to reduce the risk were made in 1987, cases have continued to appear because of the long incubation period. Notably, one of the most important epidemiologic characteristics of dura mater transmissions is the young age of the first reported cases. By 1985, a series of case reports in the United States showed that when injected, cadaver-extracted pituitary human growth hormone could transmit CJD to humans (36). Shortly thereafter, it was recognized that human gonadotropin administered by injection could also transmit CJD from person to person (37). Strain typing based on molecular PrP analysis and a polymorphism (methionine/methionine, valine/valine or methionine/valine) found at codon 129 of the PrP gene has been proposed as a tool for distinguishing between iatrogenic and sporadic CJD (12,13). Homozygosity at this site may predispose a person to acquired forms of CJD, may lead to shorter incubation periods, and has been associated with various phenotypes of the disease (11,38).The proportion of polymorphism among persons with sporadic CJD is more similar to the proportion of polymorphism among persons with iatrogenic CJD than to that in the general population (Table 2), which suggests that simple stochastic events do not fully explain sporadic CJD; were that so, the distribution of homozygosity would be the same in both healthy controls and persons with sporadic cases. The clinical symptoms in patients with iatrogenic and with sporadic CJD have been compared and are indistinguishable (18). Table 2. Amino acid phenotypes for codon 129 in patients with iatrogenic Creutzfeldt-Jakob Disease --------------------------------------------------------------------------- Homo- Total No. Tested groups Met/Met Met/Val Val/Val zygous tested (%) (%) (%) (%) (n) --------------------------------------------------------------------------- Sporadic CJD (38) 78 12 10 88 73 All Iatrogenic 60 11 29 89 63 Cases (27) CNS route of infection 80 10 10 98 20 Peripheral route of infection 51 12 37 88 43 Healthy controls (27) 37 51 11 49 261 Healthy controls (38) 48 42 10 58 1397 --------------------------------------------------------------------------- Met = methionine; Val = valine Is CJD Transmitted by Blood Transfusions? Animal Experimentation Data Human CJD has been reported to be transmitted to mice by injecting blood from human patients directly into mouse brain (39,40). However, this evidence has not been widely duplicated by other laboratories, and a comprehensive review of three decades of research with non-human primates by the National Institutes of Health indicated that the blood of humans with CJD injected either peripherally or centrally into primates did not transmit CJD (41). Some evidence indicates that blood of experimentally infected animals contains an infective agent. PrP infectivity resides predominantly or exclusively in lymphocytes and monocytes rather than in granulocytes (42,43); there has been no evidence of infectivity in erythrocytes, platelets, or plasma, but low infectivity has not been completely excluded. Animal studies have demonstrated that the agent causing scrapie replicates first in the spleen and other lymphoid tissues but reaches highest titer in the brain, where it results in the clinical appearance of disease (44). Hence, peripheral tissues in contact with blood also harbor PrP infectivity. Animal transmission data indicate that human spleen, lymph nodes, serum, and cord blood are irregularly infective for animals, although few cord blood samples have been tested (27). Brown has recently reported transmission of mouse scrapie using fractionated blood administered by intracerebral inoculation (P. Brown, Pers. Comm.). Studies of experimental CJD in guinea pigs and mice have shown that the infectious agent is present in the brain, viscera, and blood before clinical disease develops (43,45). Several factors must be considered in reviewing animal evidence regarding transmission of CJD in blood: the level of PrP infectivity of the study tissue, the species barrier, and the route of administration. Human CJD can be readily transmitted to nonhuman primates (low species barrier) by intracranial injection (high efficiency of the infective route) of contaminated brain (high titer of infectivity). Human CJD is not readily transmitted to dissimilar species (such as rodents) and is even less readily transmitted when low-titer tissues (e.g., blood cells) and/or a low efficiency route of inoculation is used. In animals, peripheral inoculation of brain tissue transmitted CJD only irregularly, but the incubation periods were comparable to central administration (41). Barriers to transmission also include the difficulties in infecting peripheral cells and crossing the blood brain barrier and possibly the lack of structural similarity between peripheral PrPCJD and brain PrPC. Strain variation may also contribute to the difficulties of transmission to animals. Deslys et al. suggest that the route of inoculation may induce strain differentiation, which then facilitates subsequent transmission by the same route (46). Others disagree (47). The evidence from animal studies is inconclusive regarding transmission of CJD between humans by transfusion, and study design and laboratory techniques are controversial. Evidence from Studies of Humans Human Case Series and Case Reports Case series and case reports provided information linking CJD to receipt of dura mater and human growth hormone. However, no human cases have yet been causatively linked to blood transfusion. A transplant recipient developed CJD (48) after receiving a liver from a donor who died of a cerebrovascular accident and had no symptoms of CJD; however, an autopsy was not performed, and brain tissue was not available for further investigation. The liver recipient did not have any of the known PrP gene coding sequences pathognomonic of familial transmission. The donor also provided a heart (to a recipient who died shortly after surgery) and a kidney (to yet another recipient; it was removed after 2 months); the latter recipient remains well. The liver recipient also received transfusions of blood, plasma, albumin, and anticytomegalovirus immunoglobulin from other donors. None of the blood donors is known to have had CJD, but one of the albumin donors died of a rapidly developing undiagnosed dementia. Four Australians have been reported with CJD following transfusion (49). The patients had cerebellar signs; however, no other evidence of iatrogenic cause was described (50). The source of blood transfusions was undocumented. Genetic testing results were not provided; it is uncertain if cases were of the familial type, and no other information on alternative iatrogenic sources was provided. In Canada, an albumin recipient died of neuropathologically confirmed CJD after receiving albumin from a pool containing blood from a person who died of neuropathologically confirmed CJD (D.G. Patry, pers. comm.). Eight months separated the receipt of albumin and development of symptoms, a much shorter period by a factor of three than seen in any other putative iatrogenic case, which makes iatrogenic transmission unlikely. A complete investigation is under way. Without an experimental, diagnostic, or epidemiologic tool that can distinguish sporadic from iatrogenic disease or link the agent from a source with a recipient, it is difficult to draw any conclusions from the case reports described above. Statistically, a certain number of persons exposed to pooled blood would be expected to develop CJD. In addition, bias is introduced into case reports because of strong suspicion regarding iatrogenic sources. Verifying the statistical probability of cases by calculating the expected number of cases is difficult, if not impossible, because CJD is rare. Surveillance Population surveys or surveillance systems of the worldwide epidemiology of CJD indicate that CJD occurs in the population at a rate of 0.05 and 1.5 cases per million per year. After 1979, the rates are 0.3 to 1.5 cases per million per year (1-8). The age distribution patterns are consistent and show that cases in persons under 30 years of age are extremely rare; cases in persons under 50 years of age are rare; and the peak age of onset is 60 to 70 years. In age-specific data, rates decline in older age groups (2,6-8,51). If CJD is transmissible in blood, cases should occur in young persons, particularly if the incubation period is short. Even if the incubation period is decades long, one would expect cases in young persons because of transfusions given to infants and children. However, CJD is rare in young persons and remains rare over time. Alternatively, the rare diagnosis of CJD in younger age groups may be due to preferences for neurologic disease diagnoses in these groups. Recent attention to nv-CJD in 14 persons under the age of 40 years in the United Kingdom, which has an intensive active surveillance system, will certainly affect investigations of unexplained mental deterioration among younger populations (22). The British Paediatric Surveillance System has initiated investigations into undiagnosed progressive neurologic disease among children (C. Verity, A. Nicoll and R. Will, pers. comm.), and Canada will initiate a similar system. In the United States, the Centers for Disease Control and Prevention has enhanced surveillance for CJD in persons under 55 years of age (52). If CJD is transmitted in blood, the last three to four decades might show a detectable increase in cases reflecting the increasing use of blood transfusions. In fact, surveillance data demonstrate that CJD rates are increasing in some countries. Interpretation of this finding is difficult: most surveillance systems were initiated in the last two decades; in countries with intensive surveillance, "catch-up" from previous underreporting led to initial increases in case numbers and rates; few countries have sufficiently intensive surveillance systems to conclude that there is no risk from blood; and the death certificates used for surveillance in some countries are sometimes incomplete, which may introduce a bias toward easily ascertained cases (8,51). If CJD is transmitted in pooled blood products, clusters would be detected; indeed, surveillance systems have expected such clusters. However, observation of one or two cases often leads to more careful search for cases. Most such clusters have been attributed to familial disease (1,53). Cluster investigations in surveillance systems have not systematically searched for blood-related transmission. Surveillance systems have found cases of CJD among persons who have received blood transfusions, but none have been linked to blood transmission. In the United Kingdom, the well-established surveillance system identified nv-CJD, despite its rarity, demonstrating the capability of surveillance to find rare diseases; nv-CJD was recognized quickly because of the young age of the patients and the novel neuropathologic findings. However, the absence of evidence is not evidence of the absence of transmission of CJD through blood, for two reasons: 1) surveillance systems designed to identify rare diseases need intensive resource allocation to detect sentinel events and 2) bloodborne transmission may go unnoticed when examining population data if unaccompanied unique epidemiologic features (such as extreme youth or novel neuropathologic features). If CJD is transmitted in blood, cases could increase in industrialized countries, where access to blood transfusion is greater. The number of reported cases is larger; however, cases have been found in every country in which they have been sought, although some countries have limited surveillance capacity. While some countries have higher rates of CJD, there is no evidence that this is due to transmissible forms of the disease. Rather, the higher rates are most likely due to older age distributions in industrialized countries' populations, surveillance biases following intensified surveillance for CJD, and familial clusters. Finally, in many surveillance systems, the age distribution pattern for CJD is uniform (2,7,8,51). The pattern is more consistent with early exposure to an agent with long incubation periods, a common population exposure that peaked long ago and is now declining, or a heritable disorder that causes shortened life-span than with a risk which increases with age (e.g., spontaneous genetic mutation or stochastic change of the normal prion to the ß-pleated form). However, CJD may be uniformly underdiagnosed in older age groups; because of nv-CJD there will likely be increased attention to differential diagnoses among elderly persons dying of rapidly progressing dementing illnesses. We do not suggest that all sporadic cases are due to external exposure such as blood, but rather we draw attention to an important epidemiologic characteristic of CJD that is not consistent with an entirely stochastic or age-related event. Case Control Studies In three countries, case-control studies of CJD have included questions regarding exposure to blood: Japan (54), the United Kingdom (55-58), and the United States (59). In the Japanese study, only one case-patient and three controls received blood transfusions. Two of the United Kingdom studies indicate no difference in exposure to blood between the case-patients and controls (55,58). A comparison of the frequency of receipt of blood among persons with CJD and controls matched for age and sex using data collected in the United Kingdom CJD surveillance system between 1980 and 1984 (56) showed no difference in the history of blood receipt between those with and without CJD. Although an odds ratio (OR) is not calculated for the data, our calculations indicate the OR is 0.78 (95% confidence interval 0.38, 1.58) with a power of only 30% to detect an OR different from one (60). Davinipour (mid-Atlantic United States) also found that blood exposure posed no risk, with an OR for blood transfusion of 0.6 (59). However, with only 26 cases, the confidence intervals or number of patients exposed was not mentioned, although the OR is described as significant. Wientjens et al. analyzed pooled data for 178 cases and 333 controls from three case-control studies (Japan, United States, United Kingdom) and did not find an OR different from one for blood transfusion (61). Although not using a formal case-control study, Operskalski et al, compared rates of human immunodeficiency virus (HIV) dementia among three HIV-positive groups (persons with hemophilia, "other blood recipients," and "blood donors") using data from the Transfusion Safety Study (62). They hypothesized that if CJD was misdiagnosed as HIV dementia but was the true cause of dementia, there would be an excess rate of HIV dementia in persons with hemophilia due to their high rates of exposure to blood and blood products (persons with hemophilia were exposed to the blood or product made from pools of hundreds of thousands if not millions of donations). In addition, since the study contained data from as early as the 1950s, long periods of observation were available. Rates of HIV dementia in the study populations were compared, and CJD in pooled plasma derivatives did not pose a risk. However, it cannot be concluded that rare diseases such as CJD would be detectable in increased rates of misdiagnosed HIV dementia or that diseases with long incubation periods may have sufficient time to develop in persons with hemophilia. Any disease with an incubation period longer than that of HIV would be in competition with AIDS and hepatitis B or C as a cause of death, and persons with hemophilia and HIV infection die young. In addition, the data included the cause of death of 1,000 HIV-infected persons but did not provide information on duration of observation or an estimate of the rate of disease that would be necessary before even one additional case would be observed. The primary weakness found in these published case-control studies is the use of the categories "exposure to blood" or "blood transfusion" as a surrogate for exposure to blood containing the agent of CJD. If the agent of CJD is frequently present in blood used for transfusions, the case-control study design is sufficiently robust to detect a risk. However, transmission of CJD through transfusion of blood contaminated with the agent of CJD appears to be rare. Consequently, a negative finding of risk attributable to blood in these studies may simply reflect an absence of exposure to the disease. Study design will have to account not only for a rare disease, but possibly for a rare exposure as well. In addition, when hospitalized persons are used as controls, the design must consider Berkson's bias, a selection bias that occurs when the selection method for controls affects the rate of exposure to the agent studied (63). The study design must then show that hospitalized controls do not have a different rate of potential exposure to blood transfusion from the general population. The use of population controls may be more appropriate for studying blood exposure. Another weakness in the existing studies was the use of a reporter, most often a relative, to collect information about exposure to blood or blood products. Oral history of blood exposure tends to underestimate the rate of exposure to blood. In one Canadian hospital conducting a retrospective study, approximately 40% of patients did not know if they had received a blood transfusion (C. Kennealy, Pers. Comm.). In a central Ontario hospital, 25% of recipients did not know if they had received a blood transfusion (S. King, Pers. Comm.). Given that CJD and transfusion-transmitted CJD (if it occurs) are rare, the published case-control studies lack the power to detect very low ORs. The 126 hemophilia centers in the United States have been asked to report deaths of persons with neurologic symptoms for neurologic confirmation of cause of death; no CJD cases have been reported in persons with hemophilia (B. Evatt and L. Schonberger, Pers. Comm.). The Canadian Haemophilia Society has requested assistance from the Health Canada, Laboratory Centre for Disease Control, to initiate a similar study in Canada (D. Wong-Reiger, Pers. Comm.). In Canada, a combined active surveillance system and case control study will begin in 1997 to identify the risk for CJD as a result of transfusion with blood from a person with CJD. Many of the methodologic problems in other studies have been addressed in the design of this study. Cohort Studies The investigation of a patient with CJD who donated 35 units of blood in 20 years identified 27 persons who definitely received his blood and eight who probably received blood; for 20 units, the recipients could not be identified (64). Eighteen (33%) of the identified recipients had died. None of the recipients had exhibited neurologic disease, although some were observed only briefly; only eight were observed for longer than 5 years. In the United States, the American Association of Blood Banks has initiated a long-term cohort investigation. By linking the names of persons who received blood from CJD patients with the national death records, the cause of death for each person will be determined. Of the 147 recipients identified, 80 have died; for 65, the cause of death is known but no cases of CJD have been found (M. Sullivan, Pers. Comm.). Cohort studies are unlikely to accumulate enough cases of exposure to allow a reasonably precise estimate of risk. However, if pooled product confers uniform risk to each recipient, data from a large number of exposed recipients can be collected. The cohort studies under way may be able to identify higher than expected rates of disease, thus indicating transmission through blood transfusion without quantifying the rate of transmission. Conclusions Many health professionals are concerned that CJD may be transmissible through blood. As noted by Brown, "iatrogenic disease from this source would dwarf in importance all other sources by virtue of the sheer number of people who theoretically have been or could be at risk" (27). Animal studies indicate that the infective agent of CJD is present in blood but in low titer, and sufficient evidence of animal transmission suggests that the disease has the potential to be transmitted through blood (65). However, human epidemiologic evidence only indicates that if blood transmission occurs, it is likely rare. Some researchers suspect that the agent of CJD is ubiquitous, therefore, we are commonly exposed to it; perhaps, another, as yet unidentified factor, "turns on" the disease. If so, is there any part of the human population that is not exposed? Most people are exposed to some components of blood products through vaccines. Some people may be protected by strain variation through exposure to nonvirulent forms, so only subgroups are susceptible to a virulent form (66). Polymorphism at codon 129 may restrict susceptibility to a small portion of the population, or most transfusions may not contain a dose large enough to cause infection. Can experimental studies answer these questions? Sufficiently large numbers of study animals could overcome problems such as the species barrier and low transmission rates due to a low dose or peripheral route of inoculation. The studies would require strict adherence to proper laboratory technique and replication in at least one other laboratory. Unanswered questions include the following: Can the transmissible spongiform encephalopathies of animals be transmitted, by transfusion, within the species when spiked blood is used? Within species from "naturally infected" blood? From humans to animals with spiked blood? From humans to animals with "naturally infected" blood? Does transmission by blood become more efficient after passage? Can human blood cells carry the agent? What are the routes for infection of the brain if infection is peripheral? Can epidemiologic methods detect blood transmission of CJD if it is rare? Epidemiologic tools such as outbreak investigations, case-control studies, and cohort studies are limited in their ability to detect rare events. In addition, during the long incubation period, patients often move away from the location where they received the transfusion; forget their exposure; and essentially lose their membership in a recognizable cohort. The absence of a test for exposure, such as an antibody test or gene sequencing of an agent as used in investigating HIV-related out-breaks, makes the investigation of iatrogenic CJD extremely difficult, hence the importance of vigilance, in the form of case reports from alert and informed clinicians, followed by critical field investigation. Surveillance systems provide the core resources for identifying and investigating unique or unexplained events. Followup case-control studies allow the observation and recording of the actual chain of exposure to blood. Acknowledgments The authors thank Drs. Paul Gully, Jamie Hockin, and Martin Tepper for their thoughtful reviews of earlier drafts of this paper and Drs. Catherine Bergeron, Michael Coulthart, and Brian Foster for discussion and scientific assistance. Dr. Ricketts is a medical specialist in the Bloodborne Pathogens Division, Laboratory Centre for Diseases Control, Ottawa, Ontario, Canada. Her research interests include the CJD surveillance system in Canada, a collaborative international study on the incidence and risk factors for CJD, and policy and infection control guidelines for CJD and other prion diseases. Address for correspondence: Maura N. Ricketts, Bloodborne Pathogens Division, Bureau of Infectious Diseases, Laboratory Centre for Disease Control, LCDC Building, PL 060 3E1, Ottawa, Ontario, K1A 0L2 Canada; fax: 613-954-6668; e-mail: mricketts@hpb.hwc.ca. References 1. Masters CL, Harris JO, Gajdusek C, Gibbs CJ, Bernoulli C, Asher DM. Creutzfeldt-Jakob disease: patterns of worldwide occurrence and the significance of familial and sporadic clustering. Ann Neurol 1979;5:177-88. 2. Brown P, Cathala F, Raubertas RF, Gajdusek DC, Castaigne P. The epidemiology of Creutzfeldt-Jakob disease: conclusion of a 15 year investigation in France and review of the world literature. Neurology 1987;37:895-904. 3. Will RG. Incidence of Creutzfeldt-Jakob disease in the European Community. In: Gibbs CJ Jr, editor. Bovine Spongiform Encephalopathy: The BSE Dilemma. New York: Springer-Verlag 1996:364-74. 4. World Health Organization consultation on clinical and neuropathological characteristics of the new variant of CJD and other human and animal TSEs. Geneva: WHO, 1996. 5. Creutzfeldt-Jakob disease in Australia: first annual report. Melbourne: The National CJD Registry, 1996. 6. Stratton E, Ricketts MN, Gully PR. Creutzfeldt-Jakob disease in Canada. CCDR 1996;22:57-61. 7. Kovanen J, Haltia M. Descriptive epidemiology of Creutzfeldt-Jakob disease in Finland. Acta Neurol Scand 1980;77:474-80. 8. Holman RC, Khan AS, Kent J, Strine TW, Schonberger LB. Epidemiology of Creutzfeldt-Jakob disease in the United States, 1979-1990: analysis of national mortality data. Neuroepidemiology 1995;14:174-81. 9. de Silva R. Human spongiform encephalopathy: clinical presentation and diagnostic tests. In: Baker H, Ridley RM, editors. Methods in molecular medicine: prion diseases. Totawa (NJ): Humana Press Inc; 1996:15-33. 10. Kretzschmar HA, Ironside JW, DeArmond SJ, Tateishi J. Diagnostic criteria for sporadic Creutzfeldt-Jakob disease. Arch Neurol 1996;53:913-20. 11. Ironside JW. Neuropathological diagnosis of human prion disease. In: Baker H, Ridley RM, editors. Methods in molecular medicine: prion diseases. Totawa (NJ): Humana Press Inc; 1996:35-57. 12. Parchi P, Castellani R, Capellari S, Ghetti B, Young K, Chen SG, et al. Molecular basis of phenotypic variability in sporadic Creutzfeldt-Jakob disease. Ann Neurol 1996;39:767-78. 13. Collinge J, Sidle DC, Meads J, Ironside J, Hill AF. Molecular analysis of prion strain variation and the aetiology of "new variant" CJD. Nature 1996;383:685-90. 14. Zerr I, Bodemer M, Otto M, Poser S, Wind IO, Kretzschmar HA, Poser S, Wind IO, Kretzschmar HA, et al. Diagnosis of Creutzfeldt-Jakob disease by two-dimensional gel electrophoresis of cerebrospinal fluid. Lancet 1996;348:846-9. 15. Hsich G, Kenney K, Gibbs CJ, Lee KH, Harrington MG. The 14-2-2 brain protein in cerebrospinal fluid as a marker for transmissible spongiform encephalopathies. N Engl J Med 1996;335:924-30. 16. Manuelidis L. The dimensions of Creutzfeldt-Jakob disease. Transfusion 1994;34:915-28. 17. Ozel M, Diringer H. Small virus-like structure in fractions from scrapie hamster brain. Lancet 1994;343:894-5. 18. Brown P, Preece MA, Will, RG. "Friendly Fire" in medicine: hormones, homografts and CJD. Lancet 1992;340:24-7. 19. Lasmézas CI, Deslys JP, Robain O, et al. Transmission of the BSE agent to mice in the absence of detectable abnormal prion protein. Science 1997;275:402-5. 20. Collinge J, Palmer MS, Dryden AJ. Genetic pre-disposition to iatrogenic Creutzfeldt-Jakob disease. Lancet 1991;337:1441-2. 21. Brown P, Gajdusek DC. The Human Spongiform Encephalopathies: Kuru, Creutzfeldt-Jakob Disease, and the Gerstmann-Straussler-Scheinker Syndrome. In: Chesebro BW, editor. Current topics in microbiology and immunology, vol 172. New York: Springer-Verlag, 1991:1-20. 22. Will RG, Ironside JW, Zeidler M, Cousens SN, Estibeiro K, Alperovitch A, et al. A new variant of Creutzfeldt-Jakob disease in the UK. Lancet 1996;347:921-5. 23. Gajdusek DC, Gibbs CJ, Alpers M. Experimental transmission of a kuru-like syndrome to chimpanzees. Nature 1966;209:794-6. 24. Gibbs CJ Jr, Gajdusek DC, Asher DM, Alpers MP, Beck E, Daniel PM, Matthews WB. Creutzfeldt-Jakob disease (subacute spongiform encephalopathy): transmission to the chimpanzee. Science 1968;161:388-9. 25. Duffy P, Wolf J, Collins G, DeVoe AG, Streeten B, Cowen D. Possible person-person transmission of CJD. N Engl J Med 1974;290:692. 26. Liberski PP, Yanagihara R, Gibbs CJ, Gajdusek DC. Spread of Creutzfeldt-Jakob disease virus along visual pathways after intra ocular inoculation. Arch Virol 1990;111:141-7. 27. Maneulidis EE, Maneulidis L. Experiments on maternal transmission of Creutzfeldt-Jakob disease in guinea pigs. Proc Soc Exp Biol Med 1979;160:233-6. 28. Brown P. Environmental causes of human spongiform encephalopathy. In: Baker H, Ridley RM, editors. Methods in molecular medicine: prion diseases. Totawa (NJ): Humana Press Inc; 1996:139-54. 29. Bernoulli C, Siegfried J, Baumgartner G, Regli F, Rabinowicz T, Gajdusek DC, et al. Danger of accidental person-to-person transmission of CJD by surgery. Lancet 1977;1:478-9. 30. Brown P. Transmissible human spongiform encepha-lopathy (infectious cerebral amyloidosis): Creutzfeldt-Jakob disease, Gerstmann-Straussler-Scheinker's syndrome and kuru. In: Calne DB, editor. Neurode-generative diseases. Philadelphia: 1994:839-76. 31. Foncin J, Gaches J, Cathala F, El Sharif E, Le Beau J. Transmission iatrogene interhumaine possible de maladie de Creutzfeldt-Jakob disease avec atteinte des grains du cervelet. Rev Neurol 1980;136:280. 32. Will RG, Matthews WB. Evidence for case-to-case transmission of Creutzfeldt-Jakob disease. J Neurol Neurosurg Psychiat 1982;45:235-8. 33. Nevin S, McMenemy WH, Berhman D, Jones DP. Subacute spongiform encephalopathy: a subacute form of encephalopathy attributable to vascular dysfunction (spongiform cerebral atrophy). Brain 1960;83:519-64. 34. Prichard J, Thadani V, Kalb R, Manuelidis E, Holder J. Rapidly progressive dementia in a patient who received a cadaveric dura mater graft. MMWR Morb Moral Wkly Rep 1987;36:49-50, 55. 35. Centers for Disease Control. Update: Creutzfeldt-Jakob disease in a second patient who received a cadaveric dura mater graft. MMWR Morb Moral Wkly Rep 1989;38:37-8, 43. 36. Esmonde T, Lueck CJD, Symon L, Duchen LW, Will RG. Creutzfeldt-Jakob disease and lyophilised dura mater grafts: report of two cases. J Neurol Neurosurg Psychiat. 1994;56:999-1000. 37. Centers for Disease Control. Fatal degenerative neurologic disease in patients who received pituitary derived human growth hormone. MMWR Morb Moral Wkly Rep 1985;34:359-60, 365-6. 38. Cochius JJ, Hyman N, Esiri MM. Creutzfeldt-Jakob disease in a recipient of human pituitary-derived gonadotropin, a second case. J Neurol Neurosurg Psych 1992;55:1094-5. 39. Brown P, Cervenakova L, Goldfarb LG, McCombie WR, Rubenstein R, Will RG, et al. Iatrogenic Creutzfeldt-Jakob disease: an example of the interplay between ancient genes and modern medicine. Neurology 1994;44:291-3. 40. Manuelidis EE, Kim JH, Mericangas JR, Manuelidis L. Transmission to animals of Creutzfeldt-Jakob disease from human blood. Lancet 1985;2:896-7. 41. Tateishi J. Transmission of Creutzfeldt-Jakob disease from human blood and urine into mice. Lancet 1985;2:1074. 42. Brown P, Gibbs CJ, Rodgers-Johnson P, Asher DM, Sulima MP, Bacote A, et al. Human spongiform encephalopathy: the NIH series of 300 cases of experimentally transmitted disease. Ann Neurol 1994;44:513-5. 43. Lavelle GC, Sturman L, Hadlow WJ. Isolation from mouse spleen of cell populations with high specific infectivity for scrapie virus. Infect Immun 1972;5:319-23. 44. Kuroda Y, Gibbs CJ, Amyx HL, Gajdusek DC. Creutzfeldt-Jakob disease in mice: persistent viraemia and preferential replication of virus in low density lymphocytes. Infect Immun 1983;41:154-61. 45. Czub M, Braig HR, Blode H, Diringer H. The major protein of SAF is absent from spleen and thus not an essential part of the scrapie agent. Arch Virol 1986;91:83-6. 46. Manuelidis EE, Gorgacs EJ, Manuelidis L. Viraemia in experimental Creutzfeldt-Jakob disease. Science 1978;200:1069-71. 47. Deslys JP, Lasmezas C, Dormont D. Selection of specific strains in iatrogenic Creutzfeldt-Jakob disease (letter) Lancet 1994;343:848-9. 48. Matthews WB. Transmission of Creutzfeldt-Jakob disease (letter). Lancet 1994;343:1575-6. 49. Creange A, Gray F, Cesaro, Adle-Biassette H, Duvoux C, Cherqui D, et al. Creutzfeldt-Jakob disease after liver transplantation. Ann Neurol 1995;38:269-72. 50. Klein R, Dumble LJ. Transmission of Creutzfeldt-Jakob disease by blood transfusion. Lancet. 1993;341:768. 51. Collins S, Masters CL. Iatrogenic and zoonotic Creutzfeldt-Jakob disease: the Australian perspective. Med J Aust 1996;164:598-602. 52. Will RG. Surveillance of prion diseases in humans. In: Baker H, Ridley RM, editors. Methods in molecular medicine: prion diseases. Totawa (NJ): Humana Press Inc., 1996;119-37. 53. Reingold A, Rothrock G, Starr M, Reilly K, Vugia D, Waterman S, et al. Surveillance for Creutzfeldt-Jakob disease-United States. MMWR Morb Moral Wkly Rep 1996;45:665-8. 54. Raubertas RF, Brown P, Cathala F, Brown I. The Question of clustering of Creutzfeldt-Jakob disease. Am J Epidemiol 1989;129:146-54. 55. Kondo K, Kuroiwa Y. A case control study of Creutzfeldt-Jakob disease: association with physical injuries. Ann Neurol 1982;11:377-81. 56. Will RG. Epidemiological surveillance of Creutzfeldt-Jakob disease in the United Kingdom. Eur J Epidemiol 1991;7:460-5. 57. Esmonde TFG, Will RG, Slattery JM, Knight R, Harries-Jones R, de Silva R, et al. Creutzfeldt-Jakob disease and blood transfusion. Lancet 1993;341:205-7. 58. Harries-Jones R, Knight R, Will RG, Cousens S, Smith PG, Matthews WB. Creutzfeldt-Jakob disease in England and Wales, 1980-1984: a case-control study of potential risk factors. J Neurol Neurosurg Psychiatry 1988;51:1113-9. 59. Esmonde TFG, Ireland BN, Will RG, Ironside J. Creutzfeldt-Jakob disease: A case-control study. Neurology 1994;44:A193 (Abstract 260P) 60. Davanipour Z, Alter M, Sobel E, Asher D, Gajdusek DC. Creutzfeldt-Jakob disease: possible medical risk factors. Neurology 1985;35:1483-6. 61. Walter SD. Determination of significant relative risks and optimal sampling procedures in prospective and retrospective comparative studies of various sizes. Am J Epidemiol. 1977;105:387-97. 62. Wientjens DPWM, Davinipour Z, Hofman A, Kondo K, Matthews WB, Will RG, van Duijn CM. Risk factors for Creutzfeldt-Jakob disease: a reanalysis of case-control studies. Neurology 1996;46:1287-91. 63. Operskalski EA, Mosley JW. Pooled plasma derivatives and Creutzfeldt-Jakob disease. Lancet 1995;346:1223. 64. Schlesselman JJ, Stolley PD. Sources of bias. In: Schlesselman JJ, editor. Case-control studies: design, conduct, analysis. New York: Oxford University Press, 1982:124-43. 65. Heye N, Hensen S, Muller N. Creutzfeldt-Jakob disease and blood transfusion. Lancet 1994;343:298-9. 66. Brown P. Can Creutzfeldt-Jakob disease be transmitted by transfusion? Current Opinion in Hematology 1995;2:472-7. 67. Deslys JP, Lasmezas CI, Billette de Villemeur T, Jaegly A, Dormont D. Creutzfeldt-Jakob disease. Lancet 1996;347:1332. --------------------------------------------------------------------------- [Emerging Infectious Diseases * Volume 3 * Number 2 * April-June 1997] Dispatches A New Tick-borne Encephalitis-like Virus Infecting New England Deer Ticks, Ixodes dammini (See footnote) Footnote. The taxonomy continues to be controversial (5). --------------------------------------------------------------------------- To determine if eastern North American Ixodes dammini, like related ticks in Eurasia, maintain tick-borne encephalitis group viruses, we analyzed ticks collected from sites where the agent of Lyme disease is zoonotic. Two viral isolates were obtained by inoculating mice with homogenates from tick salivary glands. The virus, which was described by reverse transcriptase polymerase chain reaction and direct sequencing of the amplification products, was similar to, but distinct from, Powassan virus and is provisionally named "deer tick virus." Enzootic tick-borne encephalitis group viruses accompany the agents of Lyme disease, babesiosis, and granulocytic ehrlichiosis in a Holarctic assemblage of emergent deer tick pathogens. American zoonotic foci of the agents of Lyme disease (Borrelia burgdorferi, a spirochete) and human babesiosis (Babesia microti, a protozoon) were first recognized in coastal New England and the northern Great Plains during the 1960s and 1970s (1). Human granulocytic ehrlichiosis (caused by rickettsia, Ehrlichia microti or Ehrlichia phagocytophila/equi [2]) joined this guild (3) of deer tick-transmitted pathogens (Ixodes dammini [4,5]) during the 1990s. B. burgdorferi has infected I. dammini and their rodent hosts at least from the beginning of the 20th century (6). In Eurasia, closely related and ecologically equivalent ticks (Ixodes ricinus and Ixodes persulcatus) transmit analogs of each of these agents (7), including several zoonotic variants of the Lyme disease spirochete, babesiosis (caused by Babesia divergens), tick-borne fever (caused by E. phagocytophila), and certain flaviviruses (tick-borne encephalitis [TBE]). Although analogs of three of the four members of the Eurasian guild of I. ricinus/persulcatus-transmitted pathogens are well established in North America, no arbovirus has been reported from I. dammini or other American members of the I. persulcatus species complex. Accordingly, we determined whether arboviral infection is present in adult I.dammini from deer or vegetation in coastal New England, where Lyme disease is frequent. Partially fed female ticks were removed from carcasses of deer shot by hunters during November 1995 or were derived from host-seeking ticks swept from vegetation and permitted to partially engorge on rabbits in the laboratory. All ticks were held in vials designated by site, at 4°C, and in a humidified chamber until dissection, no more than 1 month after they were removed from hosts. Each field-derived tick was dissected into a drop of sterile Hanks Balanced Salt Solution with 15% fetal bovine serum (HBSS/FBS), and one of its salivary glands was stained by the Feulgen reaction (8). The corresponding gland was pooled in 0.5 mL HBSS/FBS with that from four other ticks and was homogenized; 0.4 mL of each pool was subcutaneously injected into an adult C3H/HeJ mouse. Blood smears were made 1 week after injection to detect ehrlichiae or piroplasms. All mice were observed for 1 month. Neonatal (2 to 5 days after birth; "suckling") or subadult (<18 g) outbred CD-1 mice (Charles River Laboratories, Wilmington, MA) were used to propagate putative viral pathogens. Suckling mice were intracerebrally inoculated with 0.03 mL of a clarified and 0.22 mm filtered 20% suspension of whole mouse brain in HBSS/FBS. Alternatively, aseptically drawn plasma from putatively infected mice was directly injected. Siblings of the suckling or subadult mice received 0.03 mL of sterile HBSS/FBS. Suspensions of brain tissue from mice that had died were centrifuged, the pellet was resuspended in Trizol Reagent (BRL Life Technologies, Bethesda, MD), and RNA was extracted according to the manufacturer's protocol. RNA was reverse transcribed by using POW-1, POW-2, ENV-A and POW-6 primers. Primer design was based upon the published cDNA sequences for TBE group viruses (9). Reverse transcriptase polymerase chain reaction (RT-PCR) was performed with dedicated pipettors in an area physically separated from where amplification products were manipulated. Amplification products were excised from 3% agarose gels, purified by using the GeneClean kit (Bio 101 Inc.), and cycle sequenced at the University of Maine Biotechnology Center. Each sequence was verified by sequencing amplification products from two independent PCR reactions. These sequences (Ips1, Ips2, CT 390) have been deposited in GenBank (accession numbers U93287, U93288, U93289). To determine whether ticks that (as larvae) had fed on putatively infected mice became infected with a viral pathogen, living nymphs were directly placed in Trizol Reagent within individual screwcapped microcentrifuge tubes and allowed to remain overnight. A heat-sealed micropipet tip was used to crush each tick, and the resulting homogenate was extracted as described. RNA was analyzed for evidence of TBE group-specific env using primers POW1/POW2 in the described RT-PCR assay. Distinctive inclusions were detected by light microscopy in the Feulgen-stained salivary glands of one tick in each of two pools (Figure 1). The staining properties and shape of these inclusions were distinct from those of an ehrlichia or a piroplasm. Of the mice that were inoculated with pooled salivary tissues from these ticks with the unidentified salivary inclusions, two died approximately 14 days later after a prodrome that included signs of neurologic involvement. Ehrlichiae or babesiae were not detectable in their peripheral blood. One had received an inoculum derived from ticks sampled in a site in Massachusetts and the other from ticks in Connecticut (Table). Mice that had received salivary gland material that did not contain similar inclusions remained healthy. A neurotropic microbial pathogen was suspected. [Photo] [Figure 1] [Figures not available in ASCII version] Figure 1. Comparison of morphology and tinctorial properties of Feulgen stained, intact tick salivary glands infected by three of the deer tick pathogen guild. Spirochetes only transiently migrate through salivary tissues, and thus would not be visualized by this technique. (A) Ehrlichia microti. Polyhedral clusters of rickettsiae (arrows) within hypertrophied salivary acinus. (B) Babesia microti, dense stippling of sporoblasts (arrows). Each minute dot represents the nucleus of a sporozoite. (C) Deer tick virus. Hypotrophied salivary acinus filled with amorphous masses of pinkstaining (=Feulgen positive) material (arrows). Scale bar = 10 µm. Table. Prevalence of deer-tick virus infection in adult Ixodes dammini sampled from deer or vegetation during November 1995 from Massachusetts and Connecticut -------------------------------------------------- Sampling area* No. No. examined infected -------------------------------------------------- W MA 17 0 C MA 15 0 NE MA 157 1 SE MA 175 0 NW CT 7 1 NE CT 6 0 SW CT 26 0 SE CT 23 0 Total 465 2 -------------------------------------------------- *The deer management zones, or study sites, belong to one of four geographic quadrants for Connecticut (NE, northeastern; NW, northwestern; SE, southeastern; SW, southwestern) or of four regions in Massachusetts (W, western; C, central; NE, northeastern; SE, southeastern). To determine whether an arbovirus may have infected the two mice that died, we injected homogenized samples of brain tissue into suckling mice. Although we initially anticipated that an atypical rickettsial agent might have caused the death of these mice, we found that the putative agent could be passaged by serially inoculating clarified and filtered suspensions of brain tissue of affected mice into either suckling or adult mice. Blood or plasma from moribund mice was poorly infectious. We concluded that a neurotropic infectious agent was present in at least two of the 465 ticks that were sampled originally. To identify this microbe, RNA was extracted from an aliquant of each of the infected salivary gland homogenates and from a suspension of the brain tissue of each of the two mice that died. This preparation was used as template for an RT-PCR employing primers designed to amplify a portion of the TBE group virus nonstructural protein or envelope genes. Amplification products were sequenced and compared to viral sequences accessioned in GenBank. Parsimony analysis of the derived sequences for both genes indicated that the two viral isolates from different sites were identical, grouped within the TBE complex, but were distinct from known viruses (Figure 2). Powassan virus was the most closely related organism, with 84% pairwise similarity in the portion of the envelope gene that was analyzed. This apparently novel member of the TBE group of flavivirus is provisionally named deer tick virus (DTV). [Figure 2] [Figures not available in ASCII version] Figure 2. Maximum parsimony phylogram indicating the relationship of deer tick virus (DTV) to other tick-borne encephalitis group viruses. Sequences in GenBank for representative tick-borne flavivirus envelope genes were aligned and compared by using yellow fever virus as the outgroup. Values above branches indicate bootstrapped confidence values. Branch lengths are proportional to percent similarity in sequence. IPS 001, mouse brain derived DTV (Massachusetts isolate); CT390, mouse brain derived DTV (Connecticut isolate). POW, Powassan virus; TBE, tick borne encephalitis; TSE, Turkish sheep encephalitis; GGE, Greek goat encephalitis; LI, louping ill virus; SSE, Spanish sheep encephalitis; KFD, Kyasanur Forest disease virus; TYU, Tyuleniy virus; SRE, Saumarez Reef virus. The topology of the phylogram that was independently derived from NS-5 does not differ from that of env and is not presented. Approximately 100 ng of extracted RNA was added to a 20 mL reverse transcriptase (RT) reaction containing 5mM MgCl2, 50mM KCl, 100mM tris-HCl (pH 8.3), 5mM each of the four deoxynucleotides, 20U RNase Inhibitor, 50U RT, and 25 pmols of the appropriate downstream primer (POW-2 [5' GCTCTCTAGCTTGAGCTCCCA 3'] or POW-6 [5'TTGTGTTTCCAGGGCAGCGCCA 3']). To a 50 µL PCR reaction using the Elongase system (BRL Life Technologies) and a final Mg++ concentration of 1.5mM was added 1/20th of the RT reaction and 25pmol of primers POW-1 [5'TGGATGACAACAGAAGACATGC 3'] and POW-2, which amplify a 291 bp region of the TBE virus complex nonstructural protein gene (NS-5). Alternatively, primers POW-6 and ENV-A [5'GTCGACGACGAGGTGCACGCATCTTGA 3'] were added to amplify a 689 bp region of the TBE virus envelope gene (env). Sequences derived from RT-PCR were compared with those accessioned in GenBank. Sequence alignments were generated with the PILEUP program of the Wisconsin Genetics Computer Group, and these prealigned sequences were analyzed by parsimony using PAUP 3.1 (D. Swofford, Illinois Natural History Survey, Champaign, IL) with yellow fever virus as the outgroup. Characters were equally weighted and treated as unordered. Phylogenies were constructed by using the heuristic search option with the tree bisection reconnection branch swapping method. The robustness of the maximum parsimony tree was estimated by performing 1,000 bootstrapped replicates. Separate comparisons were done for env and NS-5 because fewer NS-5 sequences were available for many of the viruses for which there were env sequences. Suckling mice became paretic and died by 5 days after DTV was intracranially injected. During the third serial passage, the adult mouse LD50 for subcutaneous injection of a 20% brain suspension, performed in adult CD-mice, was estimated at 6.3 x 104/mL. Although adult laboratory mice died within 14 days of infection, all eight adult P. leucopus survived without apparent ill effect. White-footed mice (Peromyscus leucopus) were from a laboratory colony at the Harvard School of Public Health and represent mice originally collected from Nantucket Island in 1992. Their ability to survive infection suggests that white-footed mice may serve as reservoirs of this virus in nature. A xenodiagnosis (10) was performed to detect cryptic ehrlichial infection. We permitted noninfected, laboratory-reared larvae of I. dammini to engorge on one of the original C3H mice that showed signs of disease. After molting, the derived nymphs were permitted to engorge on outbred Swiss mice. Both mice died 2 weeks later, suggesting that DTV had been transmitted by these ticks. Indeed, two of eight nonengorged ticks from the same feeding contained DTV RNA by an RT-PCR assay. Nymphs from the same batch of larvae that had been fed on noninfected mice did not contain DTV RNA. We concluded that subadult I. dammini efficiently transmit DTV. The presence of this new TBE-like virus in New England deer ticks confirms that this guild of Ixodes-transmitted pathogens is as diverse in the Nearctic as in the Palearctic and is consistent with an original ancient Holarctic distribution of these ticks and their pathogens. We hypothesize that the guild survived the Pleistocene period in refugia located near the terminal moraine sites where the deer tick-transmitted zoonoses were first described (5). The alternative, that the American guild may have evolved in parallel with that in Eurasia, seems less persuasive. DTV may derive from Powassan virus, which mainly cycles between North American woodchucks (Marmota monax) and I. (Pholeoixodes) cookei (11), a one-host tick that is distantly related to I. dammini and only rarely feeds on humans or mice. Because deer ticks occasionally feed on woodchucks, they may carry this virus to the mouse population. Indeed, I. dammini are competent laboratory vectors of I. cookei-derived Powassan virus (12). Although the extent of geographic variation in its genes remains unknown, Powassan is as molecularly distinct from DTV as Central European encephalitis virus (also known as Western subtype of TBE) is from Russian spring summer encephalitis (also known as Eastern subtype of TBE) or Louping Ill viruses (Figure 2). DTV, therefore, may represent a new subtype of Powassan virus. Many tick-borne agents may be detected more readily if ticks are allowed to partially feed, thereby initiating reactivation (13). We regarded as unlikely the possibility that any infections detected in partially fed ticks simply represented infections that had been ingested. In that case, other ticks in the same collections would also tend to be infected. Our focus on the analysis of the salivary glands also reduces the possibility that an ingested pathogen rather than one derived from a previous bloodmeal would be detected. Indeed, the developmental cycle of these agents would not readily allow rapid invasion and residence in the salivary glands during the infecting bloodmeal (but see 14). Accordingly, the two infections detected had been transstadially passaged as opposed to periprandially acquired. [Figure 3] [Figures not available in ASCII version] Figure 3. Adult deer tick. The Feulgen reaction is DNA-specific (15); therefore, it appeared illogical that inclusions of an RNA virus would be specifically stained in our microscopy-based assay. Experimental evidence suggests, however, that glycoproteins may also be stained (16,17) in what is known as the plasmalogen reaction. The inclusions detected in tick salivary glands may, therefore, represent envelope proteins from massively replicating virus. DTV appears to be less infectious than other members of the TBE virus complex. Suspensions of suckling mouse brain tissue contained 10 to the 4th power adult mouse LD50 of virus; in contrast, similar preparations of Central European encephalitis may contain 10 to the 8th power. However, early passage virus may increase in virulence with subsequent adaptation. Suckling or adult mice that had received control inocula but lived within the same cages as virus-infected mice did not become infected, which suggests that aerosol or contaminative transmission of virus between mice is rare. The public health significance of DTV remains undescribed. TBE-like viruses tend to be virulent, causing an encephalitis with a case-fatality rate that approaches 40% or with debilitating neurologic sequelae (18,19). Although the consequences of human DTV infection are unknown, the related Powassan infection usually causes severe encephalitis (20). On the other hand, Central European encephalitis infection is frequently mild or silent (21). Our estimate of the prevalence of viral infection in adult I. dammini (0.43% of 465 ticks) is consistent with those for enzootic Central European encephalitis in present-day European sites where the risk for this infection is well-described. TBE-group viruses, however, exist in microfoci (22), and local prevalence may be greater. Residents of New England sites where the other three members of the deer tick pathogen guild are zoonotic may thus be exposed to DTV, but the infection causes a self-limited febrile illness of unknown etiology. Attempts to define the etiology of Lyme disease in the 1970s included an exhaustive search for evidence of arboviral infection in Connecticut I. dammini; none was found (23,24). Because deer ticks were less numerous then than they are now, the pathogens they transmitted might have been correspondingly infrequent. DTV may constitute an emerging fourth member of the guild of deer tick-transmitted zoonotic agents in eastern North America. The incidence of disease associated with the aggressively human-biting deer tick may continue to rise where deer populations increase. Acknowledgments We are indebted to Charles Seymour for many useful discussions and suggestions and to John David for reading the manuscript. All animal experiments were conducted according to the approved IACUC guidelines of the Harvard Medical Area. This work was supported by NIH grants AI 39002, AI 37993, AI 34409, and AI 19693; the Gibson Island Corporation; the Chace Fund; and David Arnold. Sam R. Telford III,* Philip M. Armstrong,* Paula Katavolos,* Ivo Foppa,* A. Sonia Olmeda Garcia,*† Mark L. Wilson,‡ Andrew Spielman* *Harvard School of Public Health, Boston, Massachusetts, USA; †Universidad Complutense de Madrid, Spain; and ‡Yale University School of Medicine, New Haven, Connecticut, USA References 1. Spielman A, Wilson ML, Levine JF, Piesman J. Ecology of Ixodes dammini-borne zoonoses. Annu Rev Entomol 1985;30:439-60. 2. Telford SR III, Dawson JE, Katavolos P, Warner CK, Kolbert CP, Persing DH. Perpetuation of the agent of human granulocytic ehrlichiosis in a deer tick-rodent cycle. Proc Nat Acad Sci USA 1996;93:6209-14. 3. Telford SR III, Dawson JE, Halupka K. Emergence of tickborne diseases. Science and Medicine 1997;4:24-33. 4. Spielman A, Clifford CM, Piesman J, Corwin MD. Human babesiosis on Nantucket Island, USA: description of the vector, Ixodes (Ixodes) dammini, n.sp. (Acarina:Ixodidae). J Med Entomol 1979;15:218-34. 5. Oliver JH, Owsley M, Hutcheson HJ, James AM, Chen C, Irby WS, et al. Conspecificity of the ticks Ixodes scapularis and I. dammini (Acari:Ixodidae). J Med Entomol 1993;30:54-63. 6. Marshall WF, Telford SR III, Rhys PN, Rutledge BJ, Mathiesen D, Spielman A, et al. Detection of Borrelia burgdorferi DNA in museum specimens of Peromyscus leucopus. J Infect Dis 1994;170:1027-32. 7. Aeschlimann A, Burgdorfer W, Matile W, Peter O, Wyler R. Aspects nouveux du role de vecteur joue par Ixodes ricinus L. Acta Trop 1979;36:181-91. 8. Piesman J, Mather TN, Donahue JG, Levine JF, Campbell JD, Karakashian SJ, et al. Comparative prevalence of Babesia microti and Borrelia burgdorferi in four populations of Ixodes dammini in eastern Massachusetts. Acta Trop 1984;43:263-70. 9. Mandl CW, Heinz FX, Stockl E, Kunz C. Genome sequence of tickborne encephalitis virus (western subtype) and comparative analysis of nonstructural proteins with other flaviviruses. Virology 1989;173:291-301. 10. Donahue JG, Piesman J, Spielman A. Reservoir competence of white-footed mice for Lyme disease spirochetes. Am J Trop Med Hyg 1987;36:92-6. 11. Artsob H. Powassan encephalitis. In: Monath TP, Editor. The arboviruses: epidemiology and ecology, Volume IV. Boca Raton (FL): CRC Press; 1989;29-49. 12. Costero A, Grayson MA. Experimental transmission of Powassan virus (Flaviviridae) by Ixodes scapularis ticks (Acari:Ixodidae). Am J Trop Med Hyg 1996;55:536-46. 13. Spencer RR, Parker RR. Rocky Mountain spotted fever: infectivity of fasting and recently fed ticks. Public Health Rep 1923;38:333-9. 14. Jones LD, Davies CR, Steele GM, Nuttall PA. A novel mode of arbovirus transmission involving a non-viraemic host. Science 1987;237:775-7. 15. Lillie RD. Histopathologic technique. Philadelphia: The Blakiston Company, 1948. 16. Wolman M. On the absence of desoxyribonucleic acid from some chemically induced cytoplasmic and intranuclear inclusions, with reference to a special type of false positive staining by Feulgen's nuclear technique. Journal of Pathology and Bacteriology 1954;68:159-63. 17. Kasten FH. The chemistry of Schiff's reagent. Int Rev Cytol 1960;10:1-100. 18. Grinschgl G. Virus meningo-encephalitis in Austria. II. Clinical features, pathology, and diagnosis. Bull World Health Organ 1955;12:535-64. 19. Zilber LA, Soloviev VD. Far Eastern tick-borne spring summer (spring) encephalitis. American Review of Soviet Medicine 1946;5:1-80. 20. Deibel R, Flanagan TD, Smith V. Central nervous system infections. Etiologic and epidemiologic observations in New York State. NY State J Med 1977;77:1398-404. 21. Gustafson R, Svenungsson B, Forsgren M, Gardulf A, Granstrom M. Two year survey of the incidence of Lyme borreliosis and tickborne encephalitis in a high-risk population in Sweden. Eur J Clin Microbiol Infect Dis 1992;11:894-900. 22. Gresikova M, Calisher CH. Tick-borne encephalitis. In: Monath TP, editor. The arboviruses: epidemiology and ecology, Volume IV. Boca Raton (FL): CRC Press; 1989;177-202. 23. Steere AC, Malawista SE, Snydman DR, Shope RE, Andiman WA, Ross MR, et al. Lyme arthritis: an epidemic of oligoarticular arthritis in children and adults in three Connecticut communities. Arthritis Rheum 1977;20:7-17. 24. Wallis RC, Brown SE, Kloter KO, Main AJ. Erythema chronicum migrans and Lyme arthritis: field study of ticks. Am J Epidemiol. 1978;108:322-7. --------------------------------------------------------------------------- [Emerging Infectious Diseases * Volume 3 * Number 2 * April-June 1997] Dispatches An Unusual Hantavirus Outbreak in Southern Argentina: Person-to-Person Transmission? --------------------------------------------------------------------------- Hantavirus pulmonary syndrome is a rodent-borne zoonosis first recognized in the United States in 1993. Person-to-person transmission has not been reported; however, in the outbreak of 20 cases reported here, epidemiologic evidence strongly suggests this route of transmission. In 1995, a novel hantavirus (Andes virus) was identified in samples from patients in southern Argentina (1). The patients had hantavirus pulmonary syndrome (HPS), a disease first described 2 years earlier in the United States, in association with Sin Nombre virus (a new world hantavirus) (2,3). Old World hantaviruses (Puumala, Seoul, Hantaan, and Dobrava) have been recognized causes of hemorrhagic fever with renal syndrome (HFRS) for at least 40 years and are responsible for more than 100,000 cases each year in Eurasia (4). Hantaviruses (family Bunyaviridae, genus Hantavirus) are rodent-borne viral zoonotic agents believed to be transmitted to humans primarily by inhalation of aerosols of infected rodent excretions (4). Person-to-person transmission of hantaviruses has not been reported despite extensive epidemiologic studies. Between September 22 and December 5, 1996, 18 cases of HPS occurred in residents of, or visitors to, the towns of El Bolsón, Bariloche, and Esquel in southern Argentina. Two additional persons who had contact with El Bolsón patients but had not visited the area, contracted HPS during this period (5). Five of the patients were physicians; three were directly responsible for the clinical care of an HPS patient. Epidemiologic links between all but four of the cases and evidence of low rodent population density in the area strongly suggest person-to-person transmission of HPS during this outbreak. Sporadic cases of HPS and possible cases of HFRS from as early as 1987, have been retrospectively identified in Argentina (6). In 1995, genetic material from Andes virus, a unique hantavirus, was identified in the lungs of a patient from El Bolsón (population ~15,000) in southern Argentina (1). The outbreak of HPS reported in this dispatch began on September 22, 1996, when the 41-year-old index patient (patient I) (also from El Bolsón) became ill with HPS (Figure 1). El Bolsón, a rural town in Rio Negro Province, is approximately 350 meters above sea level in the foothills of the Andes. Patients requiring intensive care are transferred to Bariloche (population 80,000), 150 kilometers to the north (Figure 2). [Figure 1] [Figures not available in ASCII version] Figure 1. Transmission tree for HPS cases in southern Argentina, September-December 1996, indicating dates of onset of symptoms, survivor status, and proposed lines of transmission. Lines of transmission are hypothetical since many of the patients had contact with multiple HPS patients. Bold lines denote husband and wife. The two sporadic cases, U and R, are not shown. [Figure 2] [Figures not available in ASCII version] Figure 2. Towns involved in the 1996 HPS outbreak in southern Argentina. Potential cases were identified by local physicians familiar with the clinical features of HPS (3) and were accepted as cases when enzyme-linked immunosorbent assay detected IgM antibodies reacting with Sin Nombre virus and/or when reverse transcriptase and polymerase chain reaction detected hantaviral RNA (1,2,6,7). Viral sequences indicated a sigmodontine-derived hantavirus related to, but clearly distinct from, Sin Nombre virus; additional sequencing and phylogenetic studies are under way. Twenty-one and 20 days, respectively, after the index patient became symptomatic, his 70-year-old mother (patient B) and one of his doctors (patient A) contracted HPS. The doctor's spouse, also a doctor (patient C), became ill with HPS 27 days after her husband's first symptoms (19 days after his death). She traveled to Buenos Aires for medical care. In a Buenos Aires hospital, an admitting doctor (patient D) spent 1 hour taking a clinical history and examining her. The doctor (patient D) applied pressure to a venipuncture site on patient C's arm with multiple layers of gauze; no obvious blood contact occurred. The only other contact between this doctor and patient C occurred 2 days later, when the doctor briefly visited the hospital's intensive care unit to attend to another patient. Twenty-four days after attending patient C, the doctor became ill with HPS. The doctor, patient D, had not traveled outside Buenos Aires, and she reported no contact with rodents during the 2 months preceding her illness (5). A 40-year-old doctor (patient E) from Buenos Aires contracted HPS 17 days after patient C was admitted to the hospital. This doctor was a friend of patients A and C and spent 3 days in El Bolsón after the death of patient A. She visited patient C often in the hospital but was not directly involved in the clinical management of any HPS patients. A fifth doctor with HPS (patient F) reported having close contact with several HPS patients. He intubated patient B and examined patients I and G. He also had daily contact with his colleague, (patient A), and spoke briefly with patient I's sister (patient H), brother-in-law (patient J), and friend (patient K). At the funeral of patient B, patient I's housekeeper (patient L) was already symptomatic. She returned to Buenos Aires by car with patients H, J, and their daughter (patient M). Symptoms developed in the latter three occupants of the car 11, 15, and 29 days, respectively, after the drive back to Buenos Aires. No evidence of rodent infestation was found when the car was examined 3 weeks later. Although patients H and J had stayed at the home of patient I for several nights, patient M had not been to El Bolsón in the preceding months, traveling only as far as Jacobacci (~250 miles from El Bolsón) for patient B's funeral. A second group of HPS cases occurred in Bariloche. Four people who had visited or worked in the hospital to which many of the El Bolsón patients were transferred (a modern 40-bed facility with a three-bed intensive care unit) contracted HPS: the hospital's night receptionist (patient N), a 40-year-old woman (patient O) who visited an unrelated patient, a 27-year-old man (patient P), and his wife (patient Q). Patients P and Q developed a close relationship with patient N during their many visits to the hospital between September 20 (when their 27-week-gestation baby was born) and October 27 (when the baby died). The three shared mate (a local tea drunk through a communal metal straw), and patient P occasionally rested on patient N's camp bed. The baby got abdominal distention and shock 37 days after birth. The clinical signs suggested necrotizing enterocolitis, but no serum or tissue specimens from the infant were available for definitive diagnosis. The remaining three HPS patients in El Bolsón during this period were men aged 44 (patient G), 29 (patient R), and 14 (patient T) years. Patients G and T were friends or acquaintances of one or more of the HPS patients, but did not recall contact with an HPS patient in the 6 weeks before the onset of their symptoms. Both patients R and U likely had coincidental sporadic cases of HPS. Patient R lived in the Chilean mountains and had prodromal symptoms of HPS on arrival in El Bolsón. Patient U, a 33-year-old man living and working in Futalaufquén National Park, Chubut Province (150 km south of El Bolsón), also contracted HPS during this period but is unlikely to have had contact with HPS patients in El Bolsón. Overall, 11 (55%) of the 20 patients were male, the mean age was 38 years (range 13-70 years), and the case-fatality rate was 50%. The death rate among cases for which epidemiologic links were identified (Figure 1) was lower during the latter stage of the outbreak (three of nine patients with onset of symptoms in November-December died compared with six of seven patients with onset of symptoms in October). The clinical picture was similar to that of HPS in the United States, although several atypical features, such as conjunctival injection and head and neck suffusion, were noted. Coughing did not occur earlier or more frequently in Argentinean HPS patients than in U.S. patients, which suggests that coughing was not the critical factor in person-to-person transmission. Early in the investigation of this outbreak, attention was focused on the index patient's brick house, one of several dwellings located on a semirural property on the outskirts of El Bolsón. Several weeks before patient I became sick, he and patients B and L moved from a wooden cabin into the brick house. Two doctors (patients A and F) made visits to this house, and patients H and J stayed there at least one night during November 1996. The 13 other HPS patients in the outbreak did not visit the house. One month after the onset of patient I's symptoms, an examination of the brick house and other nearby structures found the buildings to be well constructed with no obvious sites for rodent entry and no evidence of rodent infestation (as confirmed by trapping studies). Trapping in and around the homesites of the El Bolsón and Bariloche patients yielded few rodents. Trap success (i.e., the number of rodents captured per 100 trap nights) in neighboring areas of disturbed or natural vegetation indicated a low rodent population density. Identification and serologic testing of captured rodents are under way. The low trap success rate contrasted with that of the 1993 HPS outbreak in the southwestern United States, when rodents were plentiful overall and significantly more numerous in and around homes of patients than in and around homes of controls (8). The probable transmission of hantavirus from patient C to her doctor (Patient D) is the best epidemiologic evidence available to support the hypothesis that person-to-person transmission of hantavirus occurred during this outbreak. When considered separately, links between other Argentinean HPS patients are less convincing. However, when the contacts between patients are viewed collectively, the probability that person-to-person transmission played a major role in this outbreak strengthens. A comparison of the relative success of rodent trapping efforts over the last 20 years indicated that rodent population densities in the general area of the outbreak during the spring of 1996 were lower than average (Pearson O, pers. comm. 1996), adding further support for the hypothesis of person-to-person transmission. It is highly unlikely that the low rodent population density observed was the result of a precipitous decline in rodent populations in late spring. Rodent populations in northwest Patagonia are at minimal levels in the early spring and represent only animals that have survived the winter. Renewed reproduction increases population density throughout the spring (Guthmann N, pers. comm. 1997), as was corroborated by the high percentage of immature animals captured during trapping. Thus the rodent population density during our trapping in late spring is likely to have been higher than density when the outbreak began. The unique pattern of person-to-person transmission in this outbreak has not been a feature of hantavirus epidemiology; in fact, a study performed in New Mexico in 1993 found no disease or hantavirus antibodies in serum specimens taken from 396 health care workers, including 266 who had been exposed to patients with HPS or their body fluids 2 to 6 weeks earlier (9). The high case-fatality ratio has precluded a detailed description of the exact nature of contact between cases. Consequently, the likely mode of transmission—whether through direct contact, droplets, infectious aerosols, or contaminated fomitesis not known. Because hantaviruses are difficult to isolate and cultivate, few attempts have been made to study virus excretion from patients or to assess viral stability under different environmental conditions. Efforts to define the infectious stage of the disease and the type and duration of contact that may have led to transmission are continuing. Genetic sequences of viruses from patients and rodents are being determined to define more clearly the pattern of transmission. In the absence of any clear-cut evidence for nosocomial transmission of Sin Nombre or related viruses in the United States, it is premature to suggest changing the existing guidelines for care of HPS patients. The level of suspicion should be raised to investigate any suspected person-to-person spread of this rodent-borne zoonosis, however. Further epidemiologic and laboratory studies are needed to clarify the requirements for protecting both healthcare workers and others from hantaviral infections in Patagonia. Rachel M. Wells,* Sergio Sosa Estani,† Zaida E. Yadon,‡ Delia Enria,¶ Paula Padula,‡ Noemi Pini,† James N. Mills,* Clarence J. Peters,* Elsa L. Segura,‡ and the Hantavirus Pulmonary Syndrome Study Group for Patagonia§ *Centers For Disease Control and Prevention, Atlanta, Georgia, USA; †Instituto Nacional de Chagas "Dr. Mario Fatala Chaben," Buenos Aires, Argentina; ‡Administración Nacional de Laboratorios e Institutos de Salud, Buenos Aires, Argentina; §Instituto Nacional de Enfermedades Virales Humanas "Dr. Julio I. Maiztegui," Buenos Aires, Argentina ¶N. Guthmann, Centro Regional Universitario Bariloche; E. Argüelo, F. Klein, R. Levy, C. Nagel, Fundación Favorolo; R. Calfin, F. de Rosas, M. Lazaro, M. Rosales, P. Sandoval, Hospital Bariloche; L.A. Albornoz, R. L. Antonia, J. C. Becerra, W.H. Benitez, A. Broide, C. Flandes, A. Honik, J. Meza, L. Paganini, A. Resa, G. Roberts, P. Rodriguez, I.E. Rojo, G. Suppo, A. Werenicz, S. Wisky, Hospital El Bolson; H. Quiroga, Hospital El Hoyo; C.A. Cohen Arazi, L. Bogni, R. Lombardelli, B. Salvagno, C. Simeone, Hospital Esquel; L. Clara, Hospital Italiano de la Ciudad de Buenos Aires; M. del Castillo, Hospital Nacional de Clínicas "José de San Martín"; J.L. Becker, H. Lopez, M. Palmigiani, Instituto Nacional de Enfermedades Virales Humanas "Dr. Julio I. Maiztegui"; M. Ameztoy, A. Lawrynowicz, Instituto Nacional de Epidemiología "Dr. Juan H. Lara"; A. Edelstein, Instituto Nacional de Microbiología "Dr. Carlos Malbran"; A. Aguilera, V.O. Vigil, Instituto Nacional de Parasitología "Dr. Mario Fatala Chaben"; R. Chuit, C. Riva Posse, Ministerio de Salud y Acción Social; C. Barclay, L. Caride, E. De Orta, M. Furque, A. Picone, L. Samengo, Sanatorio San Carlos; R. Fernandez, R. Gonzales, Sistema Provincial de Salud, Esquel; O. Arellano, G. Cantoni, E. Larrieu, J. Vilosio, Sistema Provincial de Salud, PCIA de Río Negro; K. Busico, A. Khan, T.G. Ksiazek, W. Terry, J. Young, S. Zaki, Centers for Disease Control and Prevention References 1. Lopez N, Padula P, Rossi C, Lazaro ME, Franze-Fernández MT. Genetic identification of a new hantavirus causing severe pulmonary syndrome in Argentina. Virology 1996;220:223-6. 2. Nichol ST, Spiropoulou CF, Morzunov S, Rollin P, Ksiazek TG, Feldmann H, et al. Genetic identification of a hantavirus associated with an outbreak of acute respiratory illness. Science 1993;262:914-7 3. Khan A, Khabbaz RF, Armstrong L, Holman RC, Bauer SP, Graber J, et al. Hantavirus pulmonary syndrome: the first 100 cases. J Infect Dis 1996;173:1297-303 4. McKee KT, LeDuc JW, Peters CJ. Hantaviruses. In: Belshe R, editor. Textbook of human virology, 2nd edition. St. Louis: Mosby Year Book, Inc., 1991:615-32 5. Enria D, Padula P, Segura EL, Pini N, Edelstein A, Riva Posse C, et al. Hantavirus pulmonary syndrome in Argentina. Possibility of person to person transmission. Medicina (B Aires) 1995;58:709-11. 6. Parisi M, Enria D, Pini NC, Sabatini MS. Detección retrospectiva de infecciones clínicas por hantavirus en la Argentina. Medicina (B Aires) 1995;56:1-13. 7. Ksiazek TG, Peters CJ, Rollin PE, Zaki S, Nichol S, Spiropoulou C, et al. Identification of a new North American hantavirus that causes acute pulmonary insufficiency. Am J Trop Med Hyg 1995;52:1017-23. 8. Childs JE, Krebs JW, Ksiazek TG, Maupin GO, Gage KL, Rollin PE , et al. A household-based, case-control study of environmental factors associated with hantavirus pulmonary syndrome in the southwestern United States. Am J Trop Med Hyg 1995;52:393-7. 9. Vitek CR, Breiman RF, Ksiazek TG, Rollin PE, McLaughin JC, Umland ET, et al. Evidence against person-to-person transmission of hantavirus to health care workers. Clin Infect Dis 1996;22:824-6. --------------------------------------------------------------------------- [Emerging Infectious Diseases * Volume 3 * Number 2 * April-June 1997] Dispatches Pertussis in the Netherlands: an Outbreak Despite High Levels of Immunization with Whole-Cell Vaccine --------------------------------------------------------------------------- In 1996, a sudden increase in pertussis incidence was reported in the Netherlands (2.1 per 100,000 in 1995, 18 per 100,000 in 1996). Although not all potential surveillance artifacts could be excluded, it is highly probable that the data reflect a true outbreak. However, the cause of this increase has not yet been determined. Further research is directed to the severity of disease and a possible mismatch between the vaccine and the circulating Bordetella strains. In 1996, 2,771 cases of pertussis were reported to the Inspectorate of Health in the Netherlands (population 15 million), compared with 319 cases in 1995. With epidemic cycles expected every 3 to 5 years and a recent outbreak in 1994, this rise was unexpected (1). After the introduction of pertussis immunization with a whole-cell vaccine in the National Immunization Program (1952), the incidence of pertussis in the Netherlands decreased significantly. Children are immunized at ages 3, 4, 5, and 11 months with a diphtheria, tetanus, pertussis, and inactivated polio vaccine (DTP-IPV), and vaccine coverage for pertussis, for at least three immunizations, is 96% at the age of 12 months. Until the 1980s, the incidence of pertussis seemed very low, because only incidental cases were reported. However, in the last two decades, pertussis has been endemic, and epidemic peaks have appeared. The surveillance of pertussis is based mainly on notification, which was made obligatory by law in 1976. Because the availability and interpretation of serologic tests changed in the 1980s and the absence of a clear case definition for notification seemed to have influenced surveillance, a restrictive case definition that included criteria for laboratory diagnosis was introduced in 1988. Therefore, we have limited this report to notification data from 1989 onwards. The annual incidence of pertussis notification from 1989 to 1995 is shown in Figure 1. In this period, the case definition includes defined clinical symptoms and laboratory confirmation. The clinical symptoms are a serious cough lasting more than 2 weeks or cough attacks or cough followed by vomiting in combination with at least one of the following symptoms/findings: apnea, cyanosis, characteristic cough with whooping, subconjunctival bleeding, leucocytosis, or contact with a person with confirmed or suspected pertussis in the previous 3 weeks. Laboratory confirmation is defined as either positive culture of Bordetella pertussis or Bordetella parapertussis or positive two-point serology, i.e., the finding of a significant rise (> 4-fold) of IgG antibodies against pertussis toxin and/or IgA antibodies against B. pertussis in paired sera. The case definition is highly specific, but results in significant underreporting. [Figure 1] [Figures not available in ASCII version] Figure 1. Annual incidence of pertussis estimated from notification by registration date, 1989-1995. We compared the number of cases reported per 4-week-period in 1996 with the number reported in 1994, the year with the highest incidence in recent years (Figure 2). It appears that an unexpectedly large number of pertussis cases was reported (18 per 100,000) in 1996. The reports came from all over the country. No geographic clustering was observed, even in regions with pockets of low vaccination coverage or at the borders of the country (close to Germany, where vaccination coverage for pertussis is low). [Figure 2] [Figures not available in ASCII version] Figure 2. Number of cases reported by registration date, 1994 and 1996 (4-week periods). The age distribution of patients in 1989 to 1996 shows a significant decrease in the proportion of infants less than 1 year old (from 21% in 1989 to 7% in 1996) and a significant increase in the proportion of 1- to 4-year-old children (from 21% in 1989 to 30% in 1996). A significant decrease (from 42% in 1989 to 30% in 1995) was also observed in 5- to 9-year-old children; however, in 1996, the proportion increased to 39%. No changes were observed in the 10- to 14- and 15- to 19-year-old groups, whereas the proportion of patients 20 years old or older increased from 5% to 11% (Table). Table. Age distribution (percentages) pertussis notification in 1989 to 1996 --------------------------------------------------------------------------- Age 1989 1990 1991 1992 1993 1994 1995 1996 --------------------------------------------------------------------------- 0 21 21 23 21 24 16 13 7 1-4 21 21 26 19 27 34 33 30 5-9 42 37 34 30 26 32 30 39 10-14 10 9 10 17 12 8 10 11 15-19 1 2 2 2 1 1 1 2 [>=]20 5 9 6 11 10 8 12 11 Unknown 0 0 1 1 0 1 1 0 Total (n) 434 471 164 169 294 536 319 2,771 --------------------------------------------------------------------------- Whereas the average vaccine coverage did not change, the proportion of vaccinated patients increased from 55% in 1989 to 85% in 1996. In all age groups, except that of 6- to 11-month old infants, the proportion of vaccinated patients is higher in the years 1994 to 1996 than in 1989 to 1993. We estimated the annual incidence of pertussis for vaccinated and unvaccinated children ages 1 to 4 and 5 to 9 years, on the basis of reporting by registration date (1989 to 1996) (Figure 3). Calculation of incidence according to vaccination status was deliberately restricted to ages 1 to 4 years and 5 to 9 years (vaccine coverage estimated at 96%) for methodologic reasons. The changes in age-specific incidence over the years for vaccinated and unvaccinated children are identical for 1989 to 1993. However, from 1994 to 1996, and particularly in 1996, the incidence among vaccinated 1- to 4-year-olds was considerably higher than in 1989 and 1990, the years with the highest incidence in 1989 to 1993. In unvaccinated children, the incidence in 1994 and 1995 was lower than in 1989 and 1990. The difference in incidence between the period 1989 to 1990 and the year 1996 was much smaller in unvaccinated than in vaccinated persons. A similar discrepancy can be seen in the 5- to 9-year-old group. [Figure 3] [Figures not available in ASCII version] Figure 3. Estimated incidence of pertussis for unvaccinated and vaccinated children aged 1-4 years and 5-9 years based on notification records and assuming a coverage of 96% for the entire population. In view of the increase in pertussis reporting in 1996, the first issue to be addressed was whether this reporting reflected a true increase in pertussis incidence or was a surveillance artifact. If considerable underreporting is assumed, an increase due to improved compliance to the notification system or increased alertness should be considered. However, in the first two quarters of 1996, there is no apparent reason for such an assumption. Nonetheless, after the first reports of the observed rise, both publicity and increased awareness of the disease by physicians and patients might have influenced reporting. Serodiagnosis for the country as a whole is done by a single reference laboratory at the National Institute of Public Health and the Environment; thus, the data provided by the laboratory can be used for nationwide surveillance. Furthermore, the reference laboratory collects strains of B. pertussis from regional public health laboratories, and the number of strains received also reflects the epidemic curve. The epidemiologic curve derived from these sources over the past years is consistent with the notification data. Since laboratory confirmation is part of the case definition, changes in serodiagnostic practice might have influenced notification. Frequently, no conclusive results are obtained from serology: a second serum sample may not be submitted, or the first serum sample may be taken late after onset of disease, thereby missing the dynamic phase of the immunoresponse. Recently, cut-off values for antibody titers characteristic for the acute immunoresponse after natural infection with B. pertussis have been determined by comparing the titer distribution in the healthy population, in recently vaccinated children, and in sera longitudinally collected after natural infection. Since 1993, high titers in acute-phase sera are reported to be "suggestive for recent infection with Bordetella pertussis" (2). It can be imagined that such cases are reported, albeit not strictly in accordance with the case definition. To exclude the possibility that the rise in notification was the result of reporting cases diagnosed with positive one-point serology only, we linked the notification and serodiagnosis databases. (The data were taken from January 1993 to September 1996.) Special permission to link the databases was given by the Inspectorate of Health. It appeared that some notification was based on positive one-point serology as early as 1993, and this proportion increased from 20% in 1993 to 33% in 1994. It remained at this level in the subsequent years. Thus, the 1996 increase in notification cannot be attributed to this change in serodiagnostic practice. Our surveillance data suggest a decrease in vaccine efficacy, but estimation of vaccine efficacy from surveillance data should be interpreted with caution. However, there are no indications of significant bias from physicians' perceptions of vaccine efficacy that could have caused selective reporting of vaccinated patients; a higher probability of a positive serologic test result due to priming in vaccinated persons; or misclassification of cases with respect to vaccination status. Although not all potential surveillance artifacts could be excluded, it is highly probable that the surveillance data reflect a true pertussis outbreak. The outbreak could have been caused by 1) decrease in vaccination coverage, 2) decrease in vaccine quality, 3) interference with other vaccines, 4) changes in circulating strains of B. pertussis that are not covered by vaccine-induced immunity, or 5) a combination of these factors. A decrease in vaccination coverage has not been observed in the (accurate) reporting system. The whole-cell vaccine used was produced in the National Institute of Public Health and the Environment and meets international standards. There was no sign of a gradual deterioration of vaccine quality as determined for product release by the mouse protection test. In April 1993, vaccination against Haemophilus influenzae type b (Hib) was added to the immunization program. The polyribosylribitolphosphate tetanus toxoid conjugated vaccine (PRP-T) was administered simultaneously with the DTP-IPV, although on different limbs. Interference of Hib vaccination with the immunoresponse to pertussis vaccine has been described (3). In a prospective serologic study on the potential interference in the Netherlands, this effect was not observed (4). Furthermore, the increase of pertussis in 5- to 9-year-old vaccinated children, who never received Hib vaccine, was similar to the increase in the 1- to 4-year-old age group (Figure 3). Decreased vaccine efficacy due to interference of Hib vaccination is, therefore, very unlikely. Molecular typing of B. pertussis isolates collected since 1945 indicated a shift in population structure, possibly due to the introduction of whole-cell vaccine (5). Further, antigenic variants of B. pertussis distinct from the strains incorporated in the vaccine appear to have emerged (6). It might be possible that circulating strains of B. pertussis have become less sensitive to vaccine-induced immunity. The abrupt increase in the proportion of vaccinated patients reported in all age groups suggests such a change. Data from other countries in Europe indicate that the pertussis epidemic is restricted to the Netherlands. However, a resurgence of pertussis has been noted in the United States since the late 1980s and in Canada since 1991. No single factor has been found to explain this resurgence (7-10). The decrease in pertussis notification in the Netherlands at the end of 1996 may indicate a seasonal variation in incidence. The 1996 data, including those on hospital admissions, are still being analyzed. These data will give insight into the severity of the pertussis epidemic among infants. Protection of these infants is the main reason for pertussis vaccination. In January 1997, active (monthly) surveillance by pediatricians of cases among hospitalized children was added to the routine surveillance based on notification and laboratory surveillance. A prospective study is being considered to assess efficacy of the whole-cell vaccine, including differentiation of severity of illness and number of immunizations received, if the outbreak continues. Cooperative studies to determine the distribution of restriction fragment length polymorphism types and antigenic variants of B. pertussis in various countries in Europe, Asia, and North America are under way. Also, the immunogenicity of the Dutch whole-cell vaccine is being assessed: whether it has changed over time and how it compares to published immunogenicity data of whole-cell vaccines with known, prospectively determined, vaccine efficacy (11). In conclusion, in the Netherlands a sudden increase of pertussis notification has been observed, which seems to reflect a true increase in incidence. Nevertheless, the cause of this increase has not been definitively determined. A possible mismatch between the vaccine and the circulating Bordetella strains is being investigated. H.E. de Melker,* M.A.E. Conyn-van Spaendonck,* H.C. Rümke,* J.K. van Wijngaarden,† F.R. Mooi,* and J.F.P. Schellekens* *National Institute of Public Health and the Environment, Bilthoven, The Netherlands; and †Inspectorate of Health, Rijswijk, The Netherlands References 1. Melker HE de, Conyn-van Spaendonck MAE, Rümke HC, Sprenger MJW, Schellekens JFP. Kinkhoest in Nederland: 1989-1994. Nederlands Tijdschrift Geneeskunde 1995;139:1280-6. 2. Zee A van der, Agterberg C, Peeters MF, Mooi F, Schellekens JFP. A clinical validation of B. (para)pertussis PCR: comparison with culture and serology using samples of patients suspected for whooping cough from a highly immunized population. J Infect Dis 1996;174:89-96. 3. Clemens JD, Ferreccio C, Levine MM, Horwitz I, Rao MR, Edwards KM, et al. Impact of Haemophilus influenzae type b polysaccharide-tetanus-pertussis vaccine. JAMA 1992;267:880-4. 4. Labadie J, Sundermann LC, Rümke HC, and the DTP-IPV~Hib vaccine study group. Multi-center study on the simultaneous administration of DTP-IPV and Hib PRP-T vaccines. Part 1. Immunogenicity. National Institute of Public Health and the Environment (RIVM) Bilthoven, The Netherlands. Report No. 124001003, April 1996. 5. Zee A van der, Vernooij S, Peeters M, Embden J van, Mooi FR. Dynamics of the population structure of Bordetella pertussis as measured by IS1002-associated RFLP: comparison of pre- and post-vaccination strains and global distribution. Microbiology 1996;142:3479-85. 6. Mooi FR, Oirschot H van, Peeters J, Willems RJL. Antigenic variation of the accellular vaccine component pertactin in the Dutch B. pertussis population. National Institute of Public Health and the Environment (RIVM) Bilthoven, The Netherlands. Annual Report 1995. 7. Centers for Disease Control and Prevention. Resurgence of pertussis - United States, 1993. MMWR Morb Mortal Wkly Rep 1993;42:952-3,959-60. 8. Centers for Disease Control and Prevention. Pertussis - United States, January 1992-June 1995. MMWR Morb Mortal Wkly Rep 1995;44:525-9. 9. De Serres G, Bouliane N, Douville Fradet M, Duval B. Pertussis in Quebec: ongoing epidemic since the late 1980s. Can Commun Dis Rep 1995;21:45-8. 10. Milord F. Resurgence of pertussis in Monteregie, Quebec - 1990-1994. Can Commun Dis Rep 1995;21:40-4. 11. Greco D, Salmaso S, Mastrantonio P, Giuliano M, Tozzi AE, Anemona A, et al. A controlled trial of two acellular vaccines and one whole cell vaccine against pertussis. N Engl J Med 1996;334:341-8. --------------------------------------------------------------------------- [Emerging Infectious Diseases * Volume 3 * Number 2 * April-June 1997] Dispatches Invasive Haemophilus influenzae Type B Disease in Elderly Nursing Home Residents: Two Related Cases --------------------------------------------------------------------------- We investigated two fatal cases of invasive Haemophilus influenzae type b (Hib) infection in a community nursing home in western Sydney, Australia. Two elderly women had lived in the same room, and the onset of their illness was 5 days apart. Hib isolates from blood cultures showed identical profiles by pulsed field gel electrophoresis. These findings suggest that Hib infection was transmitted within this nursing home. Serious Hib disease may be underrecognized in this setting. Continued surveillance and serotyping of invasive H. influenzae disease is essential for identifying groups at increasing risk that may benefit from immunization against Hib. After the introduction of routine childhood immunization against Haemophilus influenzae type b (Hib), the incidence of invasive Hib disease fell dramatically in several countries, including Australia (1-3). This decline has been most evident among children aged less than 5 years. Meanwhile, serious Hib infections, such as pneumonia and epiglottitis, have been increasingly recognized among elderly, debilitated, and immunosuppressed adults (4-6). However, clusters of Hib infection have rarely been reported in adults. To examine their relatedness, we investigated two fatal cases of Hib septicemia in a community nursing home. Case Reports Case 1 In June 1996, a 71-year-old female nursing home resident was hospitalized after 3 days of unproductive cough, fevers, confusion, and increasing dyspnea. She had a history of cerebrovascular disease, muscular dystrophy, and congestive heart failure and was confined to a wheelchair. She had clinical signs of left lower lobe pneumonia and was afebrile. A blood film was normal, but a chest X-ray showed extensive bilateral pulmonary infiltrates. Arterial blood gases showed severe hypoxia in room air (PO2 44 mm Hg, saturation 77%). Ceftriaxone 1 g and metronidazole 500 mg were given intravenously for suspected aspiration pneumonia, but the patient became severely hypotensive and died 8 hours after admission to the hospital. The following day, betalactamase-negative Hib was isolated from blood cultures collected before the patient died. Case 2 Two days after the first patient was hospitalized, an 80-year-old female resident of the same nursing home became ill with fever and sore throat. She had a history of chronic airflow limitation, mild renal impairment, and dementia. Her sore throat rapidly worsened, and the next day she was hospitalized with severe dysphagia. On examination, she was febrile (38.5°C) and hypotensive (90/60 mm Hg) and had pretracheal cellulitis. No clinical evidence of pneumonia was observed, and a chest X-ray was normal. She was intubated, and extensive epiglottitis, laryngitis, and tracheitis were noted. Ceftriaxone 2 g, gentamicin 80 mg, flucloxacillin 1 g, and metronidazole 500 mg were administered intravenously. Inotropes were given for hypotension and acute renal failure, but the patient's condition deteriorated rapidly, and she died 9 hours after admission to the hospital. Beta-lactamase-negative Hib was subsequently isolated from blood cultures collected before the patient died. Investigation For several months, these two women had occupied beds in the same six-bed room (the largest room) in the 44-bed nursing home. The home employed 37 nursing and ancillary staff. During 3 weeks before the investigation, 20 residents and several staff had been unwell with bronchitis, for which many had received oral antibiotics. No sputum samples had been collected for culture from residents or staff. Two other elderly residents had died during the preceding 10 days, but their case notes did not document any fever or symptoms suggesting infection. On the first day of our investigation, two elderly residents were febrile. One woman had bilateral bronchopneumonia that was not responding to oral cefaclor and was hospitalized; blood and sputum cultures yielded no pathogens, and urine samples did not contain Hib capsular antigen. The other woman had been febrile for 1 week, with a cellulitic leg ulcer and pleuritic chest pain of uncertain etiology. Because of her other chronic illnesses she was treated palliatively and died 1 week later. A swab of her leg ulcer yielded group G streptococcus, blood cultures were negative, and sputum was not obtained. Throat swabs were collected from all 81 residents and staff at the nursing home and cultured for Hib on bacitracin chocolate blood agar. We administered rifampicin chemoprophylaxis to all roommates of the index case patients and 28 staff who had been in regular close contact with the two case patients during the week before their illness. No new febrile illnesses occurred during 3 weeks of follow-up, and Hib was not isolated from any throat swab cultures. The Hib isolates from the first and second patients were examined by pulsed field gel electrophoresis and had identical profiles that were distinguishable from several epidemiologically unrelated isolates (Figure). [Image] [Figures not available in ASCII version] Figure. Pulsed field gel electrophoresis of Haemophilus influenzae type b (Hib) isolates from blood culture of two elderly nursing home residents (lanes 1 and 2) compared with epidemiologically unrelated H. influenzae isolates sent to our laboratory for typing: lane 3, laboratory Hib strain; lane 4, non-H. influenzae; lane 5 and 12, invasive nontypeable H. influenzae; lane 6-11, unrelated Hib isolates; lane 13, H. influenzae type a; lane 14, 1 kilobase molecular marker. The enzyme used for DNA digestion was Apal. The relationship of these two fatal cases of Hib disease in time and place and the clonality of the isolates provide good evidence that transmission of Hib infection occurred in this nursing home. We were unable to demonstrate that Hib caused any of the associated reports of bronchitis and febrile illness among residents and staff, and our prevalence study did not show any asymptomatic Hib carriage. However, the survey was performed 10 days after the onset of the second case of septicemia following widespread use of antibiotics, and it may not have accurately reflected the prevalence of Hib carriage at the time these cases occurred. It is also difficult to evaluate whether chemoprophylaxis was a useful intervention in this setting. To our knowledge, this is the first reported cluster of invasive Hib infection among adults in a community-based nursing home. Three other clusters of Hib infection in adults have been described: one occurred in a nursing home attached to a hospital, and two were nosocomial—including a cluster of bronchitic illness (7-9). Our report provides further evidence that Hib can cause clusters of serious disease among the elderly—at least in institutions. Given that diagnostic procedures are performed infrequently in many community nursing homes, Hib infection may be underrecognized in this setting. We were especially interested in these two cases in adults as they were the only instances of invasive Hib disease reported to this Public Health Unit from its population base of one million persons over 12 months—a rate of 0.3 per 100,000 population aged 15 years and older. This pattern of notification differs markedly from that observed in western Sydney at the time childhood Hib vaccination was first introduced in mid-1992. In 1992, 27 of 30 notifications of invasive Hib disease in this area were of children aged less than 5 years, or 36.9 per 100,000 population (New South Wales Health Department, unpub. data). Although invasive Hib infection remains uncommon in adults in communities where childhood Hib vaccination is routine, the relative frequency of invasive Hib infection is increasing in older age groups. Population-based studies of acute epiglottitis undertaken in northern California and Rhode Island have also shown that the incidence of childhood epiglottitis is falling rapidly since the introduction of Hib immunization, while the incidence of epiglottitis in adults remains steady or is increasing (10,11). Acute epiglottitis in children is usually caused by Hib, and the falling incidence of epiglottitis in this age group is explainable by immunization. In adults, most culture-positive cases of acute epiglottitis are also caused by Hib (10,12). However, the incidence of Hib-related epiglottitis in adults does not appear to be changing appreciably—at least in Rhode Island—and Hib does not account for the increasing incidence of epiglottitis observed in this age group (10). Indeed, acute epiglottitis is frequently culture negative in adults, so explaining its increasing incidence and ascertaining the etiologic agents in older age groups require further study (10,12). Invasive Hib disease should continue to be monitored in all age groups after the introduction of childhood immunization against Hib. Evidence suggests that Hib immunization reduces the acquisition of Hib carriage in children, and reduced carriage among children may indirectly prevent Hib disease in adults (13). However, surveillance data in western Sydney and metropolitan Atlanta have not supported this hypothesis; rates of adult Hib disease are remaining approximately unchanged, despite dramatic reductions in childhood disease (5; New South Wales Health Department, unpub. data). Only by serotyping isolates of H. influenzae that cause invasive disease will it be possible to detect changing patterns of invasive Hib disease in adults during this era of childhood immunization. Serotype-specific surveillance of invasive H. influenzae disease is also needed to assess progress towards the elimination of childhood Hib disease. In addition, periodic cross-sectional serotyping studies of H. influenzae isolates causing noninvasive disease would help measure the effects of Hib immunization on the incidence of less serious forms of Hib infection. These surveillance methods will identify groups at increasing or underrecognized risk that may benefit from immunization. Acknowledgments The authors thank Graham O'Donnell (Department of Microbiology, Westmead Hospital) and Marianne Kerr and Oanh Nguyen (Western Sector Public Health Unit). The Master of Applied Epidemiology Program is funded by the Commonwealth Department of Health and Family Services, Canberra. Timothy C. Heath,*† Moira C. Hewitt,†‡ Bin Jalaludin,* Christine Roberts,† Anthony G. Capon,* Peter Jelfs,§ and Gwendolyn L. Gilbert§ *Western Sector Public Health Unit, North Parramatta, New South Wales; †Australian National University, Australian Capital Territory, Australia; ‡Department of Public Health and Community Medicine, Westmead, New South Wales; and §Institute of Clinical Pathology and Medical Research, Westmead, New South Wales References 1. Adams WG, Deaver KA, Cochi SL, Plikaytis BD, Zell ER, Broome CV, Wenger JD. Decline of childhood Haemophilus influenzae type b (Hib) disease in the Hib vaccine era. JAMA 1993;269:221-6. 2. Peltola H, Kilpi T, Antilla M. Rapid disappearance of Haemophilus influenzae type b meningitis after routine childhood immunisation with conjugate vaccines. Lancet 1992;340:592-4. 3. Herceg A, Oliver G, Andrews G, Curran M, Crerar S, Andrews R, Evans D. Annual report of the National Notifiable Diseases Surveillance System, 1995. Communicable Diseases Intelligence 1996;20:451. 4. Alho OP, Jokinen K, Pirila T, Ilo A, Oja H. Acute epiglottitis and infant conjugate Haemophilus influenzae type b vaccination in northern Finland. Arch Otolaryngol Head Neck Surg 1995;121:898-902. 5. Farley MM, Stephens DS, Brachman PS, Jr., Harvey RC, Smith JD, Wenger JD. Invasive Haemophilus influenzae disease in adults. A prospective, population-based surveillance. CDC Meningitis Surveillance Group [see comments]. Ann Intern Med 1992;116:806-12. 6. Casadevall A, Dobroszycki J, Small C, Pirofski LA. Haemophilus influenzae type b bacteremia in adults with AIDS and at risk for AIDS [see comments]. Am J Med 1992;92:587-90. 7. Smith PF, Stricof RL, Shayegani M, Morse DL. Cluster of Haemophilus influenzae type b infections in adults. JAMA 1988;260:1446-9. 8. Patterson J, Madden GM, Krisiunas EP, Masecar B, Hierholzer WJ Jr., Zervos NJ, Lyons RW. A nosocomial outbreak of ampicillin-resistant Haemophilus influenzae type b in a geriatric unit. J Infect Dis 1988;1002-7. 9. Howard AJ, Owens D, Musser JM. Cross-infection due to Haemophilus influenzae type b in adults. J Hosp Infect 1991;19:70-2. 10. Frantz TD, Rasgon BM. Acute epiglottitis: Changing epidemiologic patterns. Otolaryngol Head Neck Surg 1993;109:457-60. 11. Mayo-Smith MF, Spinale JW, Donskey CJ, Yukawa M. Acute epiglottitis - an 18 year experience in Rhode Island. Chest 1995;108:1640-7. 12. Berg S, Nylen O, Hugosson S, Prellner K, Carenfelt C. Incidence, aetiology, and prognosis of acute epiglottitis in children and adults in Sweden. Scand J Infect Dis 1996;28:261-4. 13. Barbour ML, Mayon-White RT, Coles C, Crook DWM, Moxon ER. The impact of conjugate vacine on carriage of Haemophlilus influenzae type b. J Infect Dis 1995;171:93-8. --------------------------------------------------------------------------- [Emerging Infectious Diseases * Volume 3 * Number 2 * April-June 1997] Dispatches Seroepidemiologic Studies of Hantavirus Infection Among Wild Rodents in California --------------------------------------------------------------------------- A total of 4,626 mammals were serologically tested for antibodies to Sin Nombre virus. All nonrodent species were antibody negative. Among wild rodents, antibody prevalence was 8.5% in murids, 1.4% in heteromyids, and < 0.1% in sciurids. Of 1,921 Peromyscus maniculatus (deer mice), 226 (11.8%) were antibody positive, including one collected in 1975. The highest antibody prevalence (71.4% of 35) was found among P. maniculatus on Santa Cruz Island, off the southern California coast. Prevalence of antibodies among deer mice trapped near sites of human cases (26.8% of 164) was significantly higher than that of mice from other sites (odds ratio = 4.5; 95% confidence interval = 1.7, 11.6). Antibody prevalence increased with rising elevation (>1,200 meters) and correlated with a spatial cluster of hantavirus pulmonary syndrome cases in the Sierra Nevada. In spring 1993, a cluster of unexplained severe acute respiratory illnesses associated with a high death rate was reported in the southwestern United States (1). The outbreak was linked to a newly recognized hantavirus strain, Sin Nombre virus (SNV), carried by the deer mouse, Peromyscus maniculatus (2-5). Sporadic cases of the illness, hantavirus pulmonary syndrome (HPS), were subsequently identified in other regions of North America, especially the western United States (6,7). Three additional pathogenic viruses associated with HPS were later discovered outside the usual range of P. maniculatus: 1) Black Creek Canal virus, harbored by the cotton rat, Sigmodon hispidus, in Florida; 2) Bayou virus, identified in the rice rat, Oryzomys palustris, in Louisiana; and 3) New York virus, isolated from the white-footed deer mouse, Peromyscus leucopus, in New York (8-12). These viruses have not been found in California; however, two novel hantaviruses, El Moro Canyon virus (EMCV) and Isla Vista virus (ISLA), were recently discovered in that state (13-15). Genetic studies identified the harvest mouse, Reithrodontomys megalotis, and the California meadow vole, Microtus californicus, as the reservoirs for EMCV and ISLA, respectively. Human infection with EMCV and ISLA has not been documented. Through 31 January 1997, 156 cases of HPS were reported to the Centers for Disease Control and Prevention (CDC); the case-fatality rate is approximately 50% (T. Ksiazek, P. Rollin, unpub. data). HPS has been confirmed in 26 states, with California reporting the third largest number of cases (14 cases, 8 deaths), after New Mexico (29 cases) and Arizona (22 cases). Hantaviruses are excreted in the urine, feces, and saliva of asymptomatic infected rodents (16). Transmission to humans occurs when aerosols contaminated with the virus are inhaled (16-18). Bites by infected rodents or exposure to broken skin or mucous membranes may represent alternative routes. Although specific risk factors are poorly defined, persons engaging in activities that bring them in contact with rodents and/or their excretions may be at a higher risk for infection (19). The present study compiles retrospective and prospective serologic data to 1) confirm P. maniculatus as the primary reservoir of SNV and identify alternative reservoirs, if any, in California; 2) assess differences in SNV seroprevalence in vector populations from various geographic regions; and 3) compare seroprevalence rates of reservoirs collected near sites of human cases with those from other sites. The Study Mammal Surveys The California Department of Health Services (CDHS) contacted 18 agencies (local vector control districts, local health and environmental health departments, universities, state and national park and forest services, the military, and wildlife refuges) involved in cross-sectional surveys of California mammals to participate in developing a centralized, statewide database of SNV serologic results and ecologic data. Historical surveys used archived specimens collected in 1975, 1976, and 1988 and stored at the University of California, Berkeley, Museum of Vertebrate Zoology, and specimens collected from 1989 through early 1993 by local vector control districts. Prospective surveys and human case investigations were conducted from late 1993 through the end of 1995. Wild rodent trapping and processing methods were as previously described (20). Reports by participating agencies included ecologic data on individual mammals (species, age, and sex). Information on survey sites included county, physical location of trapline, date of survey, elevation, and habitat. Habitat was categorized by a single dominant vegetation type: chaparral, conifer trees, grassland, hardwood trees, sage/scrub brush, or urban environment (21). Human Cases Within 2 weeks after a confirmed diagnosis of HPS, the patient or a surrogate was interviewed to determine potential sites of exposure to infected rodents. An environmental/ecologic investigation was conducted at possible sites of exposure (20,22). Laboratory Studies Rodent serum samples were tested by one or more of six laboratories (CDC; CDHS; University of New Mexico; University of California, Davis; and University of Nevada, Reno). Serum samples were examined for IgG antibodies to the SNV nucleocapsid protein by Western blot and/or enzyme-linked immunosorbent assay with CDC reagents (23,24). For archived specimens, liver tissue from frozen carcasses was used for polymerase chain reaction (PCR) (22,25). Data Analysis Descriptive data were analyzed by Epi Info, Version 6.0 (26). Frequency distributions were obtained, and chi-square tests of homogeneity for two-by-two contingency tables were used to examine the statistical significance of any association. A crude relationship between altitude and SNV-antibody prevalence was assessed by the Mantel-Cox test for trend. Adjusted odds ratios and 95% confidence intervals were calculated by logistic-binomial regression (27). A random effects model was chosen because of the presence of important clustering effects from the sampling design. The presence or absence of antibodies to SNV was the primary dependent variable, and characteristics that were identified in the descriptive analysis were the independent variables. Data from samples collected on the Channel Islands were analyzed separately from mainland data where indicated. Sin Nombre Virus Antibody Prevalence California Mammals A total of 4,626 (4,549 rodent and 77 nonrodent species) mammals representing 47 species were collected between 1975 and 1995 in California and serologically tested for IgG antibodies to SNV (Table 1). Wild rodents (most 3,109, from the family Muridae) made up 98% of the sample, followed by Sciuridae (1,369), and Heteromyidae (71). Among the Muridae, 78% were deer mice or related species, 11% were wood rats, 6% were domestic rodents (house mice, rats), 3% were harvest mice, and fewer than 1% were meadow voles or cotton rats. Antibodies to SNV were found only among wild rodents. Prevalence of antibodies reactive with SNV was 8.5% among the Muridae, 1.4% among the Heteromyidae, and less than 0.1% among the Sciuridae. Nonrodent species tested included 74 carnivores (five domestic dogs, Canis familiaris; 26 coyotes, Canis latrans; 25 Island foxes, Urocyon littoralis; six domestic cats, Felis domesticus; two opossums, Didelphis virginiana; three striped skunks, Mephitis mephitis; seven raccoons, Procyon lotor), one black-tailed jackrabbit, Lepus californicus, one Nuttall's cottontail, Silvilagus nuttallii, and one shrew, Sorex sp. Table 1. Prevalence of antibodies to Sin Nombre virus among wild rodents in California, 1975-1995 --------------------------------------------------------------------------- Family/ Common No. No. % Species Name Tested Pos. Pos. --------------------------------------------------------------------------- Heteromyidae Dipodomys sp. kangaroo rats 28 1 3.6 Perognathus sp. pocket mice 43 0 0.0 SUBTOTAL 71 1 1.4 Muridae Microtus sp. meadow voles 29 5 17.2 M. californicus California 22 5 22.7 meadow vole M. montanus Montane vole 3 0 0.0 M. townsendii Townsend's vole 1 0 0.0 Mus musculus house mouse 88 0 0.0 Neotoma sp. wood rats 330 2 0.6 N. cinerea bushy-tailed 20 0 0.0 wood rat N. fuscipes dusky-footed 215 2 0.9 wood rat N. lepida desert wood 95 0 0.0 rat Peromyscus sp. deer mice 2430 236 9.7 P. boylii brush mouse 98 0 0.0 P. californicus California 159 4 2.5 mouse P. crinitus canyon mouse 29 2 6.9 P. eremicus cactus mouse 100 1 1.0 P. maniculatus deer mouse 1921 226 11.8 P. truei pinyon mouse 123 7 5.7 Rattus norvegicus Norway rat 11 0 0.0 Rattus rattus roof rat 99 0 0.0 Reithrodontomys megalotis harvest mouse 108 16 14.8 Sigmondon hispidus cotton rat 14 0 0.0 SUBTOTAL 3109 263 8.5 Sciuridae 1369 1 <0.1 Ammonospermophilus antelope 4 0 0.0 leucurus ground squirrel Spermophilus sp. ground 1205 1 <0.1 squirrels S. beecheyi California 856 1 0.1 ground squirrel Tamias sp. chipmunks 152 0 0.0 Tamiascurus douglasii Douglas' 5 0 0.0 squirrel SUBTOTAL 1369 1 <0.1 TOTAL 4549 245 5.4 --------------------------------------------------------------------------- Deer Mouse Populations Of 1,921 P. maniculatus, 226 (11.8%) had antibodies to SNV (Table 1). Other peromyscine-related species (e.g., cactus mice, canyon mice, California mice, and pinyon mice) also had antibodies to SNV, but prevalence was lower. In almost all instances, infected P. maniculatus were collected at the same site as SNV-antibody-positive animals of other species. Retrospectively, antibodies to SNV were identified in 3 (6.0%) of 50 deer mice specimens collected in 1975 (1 of 22, 4.5%), 1976 (2 of 17, 11.8%), 1981 (0 of 2), 1992 (0 of 1), and early 1993 (0 of 8). The three seropositive P. maniculatus collected by the University of California, Berkeley in 1975 and 1976 were from Alameda, Kern, and Mono Counties. Frozen liver tissue available from the seropositive Kern County specimen yielded a PCR sequence of the G1 amplimer of SNV that differed from a P. maniculatus collected in nearby Mono County in 1994 by only five residues out of 274. The largest comparative protein dissimilarity was with a P. maniculatus from the Channel Islands, which differed by seven amino acid substitutions. Among the deer mice for which age (1,165 animals, 87% adults) and sex (1,239 animals, 57% male) were available, SNV antibody prevalence was, respectively, 13.5% in adults and 6.7% in juveniles and 13.0% in males and 10.1% in females. Differences in age (chi-square = 5.5) and sex (chi-square = 2.5) were not significant. Geographic Distribution Thirty-four of the state's 58 counties were surveyed (Table 2). Antibodies to SNV were identified in deer mice from 21 (62%) of these counties (Figure 1). Most samples were from coastal counties (56%), followed by foothill/mountainous (36%) and inland/valley (8%) counties. Among these, the prevalence was 14.5% of 684 in the foothills/mountains, 11.6% of 112 on the coast, and 0.7% of 151 in the inland/valley areas. Table 2. Prevalence of antibodies to Sin Nombre virus among Peromyscus maniculatus by county, California, 1975-1995 -------------------------------------------------------------------------- No. survey No. No. % County sites tested pos. pos. -------------------------------------------------------------------------- COASTAL Alameda 2 6 1 16.7 Contra Costa 1 36 0 0.0 Del Norte 2 19 0 0.0 Los Angeles 10(8) 112(71) 13(11) 11.6(15.5) Marin 2 153 3 2.0 Mendocino 1 13 0 0.0 Monterey 2 52 5 9.6 Orange 8 52 3 5.8 San Diego 32 131 7 5.3 San Francisco 1 30 0 0.0 San Luis Obispo 2 4 0 0.0 San Mateo 1 40 8 20.0 Santa Barbara 6(2) 294(81) 86(7) 29.3(8.6) Sonoma 1 7 0 0.0 Ventura 5(3) 137(9) 0(0) 0.0(0.0) SUBTOTAL 76(68) 1086(704) 126(45) 11.6(6.4) INLAND/VALLEY Imperial 1 2 1 50.0 Riverside 10 57 0 0.0 Sacramento 1 36 0 0.0 San Bernardino 4 49 0 0.0 San Joaquin 1 7 0 0.0 SUBTOTAL 17 151 1 0.7 FOOTHILLS/MOUNTAINS Butte 12 115 14 12.2 El Dorado 1 25 0 0.0 Glenn 1 4 0 0.0 Inyo 2 3 1 33.3 Kern 5 66 7 10.6 Mariposa 1 46 7 15.2 Mono 8 107 17 15.9 Nevada 1 52 26 50.0 Placer 2 29 2 6.9 Plumas 4 35 1 2.9 Shasta 3 30 4 13.3 Siskiyou 4 117 12 10.3 Tehama 1 35 5 14.3 Tulare 1 20 2 10.0 SUBTOTAL 46 684 99 14.5 TOTAL 139 1921 226 11.8 -------------------------------------------------------------------------- *Numbers in parentheses exclude the Channel Islands in Los Angeles (Catalina, San Clemente), Santa Barbara (San Miguel, Santa Barbara, Santa Cruz, Santa Rosa), and Ventura (Anacapa, San Nicolas) counties. [Figure 1] [Figures not available in ASCII version] Figure 1. Geographical distribution of hantavirus pulmonary syndrome cases and occurrence of Sin Nombre virus antibodies among deer mice (Peromyscus maniculatus), California, 1975-1995 (n=1,921). One hundred and thirty-nine individual sites were surveyed within 34 counties with a mean of four sites per county (Table 2). Antibody prevalence at individual sites was 0.0% to 71.4% (25 of 35 tested on Santa Cruz Island, Santa Barbara County). In the Sierras, the highest antibody prevalence (50.0% of 52) was found in deer mice captured in Truckee, Nevada County, during a human case-patient investigation (Table 3, Case 3). At least one SNV-antibody-positive mouse was detected at each mainland site where 38 or more mice were tested. Table 3. Characteristics of selected hantavirus pulmonary syndrome cases and prevalence of antibodies to Sin Nombre virus in Peromyscus maniculatus collected at candidate sites of exposure, California, 1994-1995* --------------------------------------------------------------------------- Onset Outcome Suspect Predominant Elevation No. % Date County Vegetation (meters) Rodents Pos. Patient of Exposure Tested --------------------------------------------------------------------------- 1 09/94 Nonfatal Mono conifer, 1801-2100 34 14.7 sage brush 2 03/95 Nonfatal Mono conifer, 1801-2100 22 13.6 sage brush 3 04/95 Nonfatal Nevada sage brush 1801-2100 52 50.0 4 06/95 Fatal Mono conifer, 1801-2100 11 54.5 sage brush 5 09/95 Fatal Placer/Nevada conifer 1501-1800 26 7.7 6 10/95 Nonfatal Plumas conifer 1201-1500 19 5.3 Total 164 26.8 --------------------------------------------------------------------------- *Rodent studies associated with California HPS cases described in greater detail (20,22,29). Channel Islands The Channel Islands, a group of eight islands located south of the Santa Barbara-Los Angeles coast, are 20 km (Anacapa) to 98 km (San Nicolas) from the mainland and 5 km to 45 km from each other. Despite the proximity between them, SNV-antibody prevalence varied significantly between islands. Antibody prevalence in deer mice trapped on the islands (20.9% of 382) was significantly higher than that of deer mice from the mainland (chi-square = 40.9, p < 0.001). In addition, Channel Island sequences differed by approximately 17% to 19% from any mainland California sequences (22,25). The highest prevalence was found on Santa Cruz and Santa Rosa Islands, where, respectively, 25 (71.4%) of 35 and 47 (58%) of 81 deer mice were SNV-antibody positive. Antibody prevalence among deer mice on the other islands was 7 (17.9%) of 39 on San Miguel, 1 (14.3%) of 7 on Santa Catalina, and 1 (2.9%) of 34 on San Clemente. However, deer mice sampled on Anacapa (n=37), San Nicolas (n = 91), and Santa Barbara (n = 58) Islands were all SNV-antibody negative. Habitat A higher SNV-antibody prevalence was observed in the Sierra Nevada, Great Basin, and southern coastal habitats (Figure 1). Likewise, antibody prevalence was higher among deer mice trapped in vegetation associated with these environments: 15.1% of 531 in conifer, 14.8% of 597 in grassland, 13.4% of 86 in hardwood, 11.2% of 165 in sage/scrub brush, and 5.8% of 474 in chaparral. In urban environments, only 2.9% of 68 deer mice were SNV-antibody positive. Antibody prevalence among deer mice increased significantly (p < 0.001) with rising altitude (Figure 2). In the regression model, adjusted odds ratios steadily increased with elevation, peaking at 4.3 in the 1,800- to 2,100-meter range (95% confidence intervals = 1.3, 16.7) (Table 4). The increased prevalence of SNV antibodies in deer mice trapped at higher elevations correlated with an increased incidence of HPS cases at elevations above 1,200 meters (Table 3). Table 4. Odds ratios for Sin Nombre virus antibody prevalence among Peromyscus maniculatus by association with human cases and elevation, California, 1975-1995(a) --------------------------------------------------------------------------- Cases Controls Adj. (+SNV) (-SNV) OR(c) 95% CI(c) p value --------------------------------------------------------------------------- Human case(d) Absent 101 1274 1.0 NA(c) NA Present 44 120 4.5 1.7-11.6 0.002 Elevation (meters) 0-300 32 580 1.0 NA NA 301-600 2 101 0.4 0.4-3.5 0.423 601-900 11 83 0.6 0.2-1.8 0.390 901-1200 8 85 2.4 0.7-8.6 0.168 1201-1500 26 234 3.2 1.0-10.0 0.044 1501-1800 23 152 2.6 0.7-9.2 0.151 1801-2100 26 103 4.3 1.3-16.7 0.032 --------------------------------------------------------------------------- (a)Excludes Channel Islands; (b)Adjusted for trapline location and survey date, vegetation, sex and age of deer mouse; (c)OR, odds ratio; CI, confidence interval; NA, not applicable; (d)Deer mice collected at candidate sites of exposure during human case investigations. [Figure 2] [Figures not available in ASCII version] Figure 2. Prevalence of Sin Nombre virus antibodies among deer mice (Peromyscus maniculatus) by elevation, California, 1975-1995 (n=1,539, excluding Channel Islands). Human Cases HPS cases were spatially clustered in the state's Sierra Nevada region (Figure 1). Results from antibody prevalence studies among rodents collected during the investigation of six HPS cases in California are presented in Table 3. Antibody prevalence in deer mice trapped at these sites was significantly higher than at sites not associated with a human case (odds ratio = 4.5; 95% confidence interval = 1.7, 11.6) (Table 4). Reservoirs of Hantavirus in California Extensive serologic testing unequivocally identified P. maniculatus as the primary reservoir of SNV in California, as did previous studies in the western United States (2,20,28-30). The overall prevalence of SNV antibodies in deer mice (11.9%) in California is also comparable with results published by nearby western states such as Montana (8.0%) and Nevada (12.5%) (28,30). Other peromyscine rodents (e.g., canyon mice and pinyon mice) may harbor the virus in California, but at much lower levels. Because these related wild mice species frequently inhabit the same environment as P. maniculatus, their infections may represent transmission from the primary reservoir population rather than from each other, as would occur in a permanent virus-species relationship. The extremely low prevalence of SNV antibodies (Table 1) in heteromyids (kangaroo rats, pocket mice), sciurids (ground squirrels, chipmunks), and Old World murids (domestic mice and rats), despite a large sample size (> 1,600), suggests that these animals are not important in the epidemiology of SNV in California. Positive serologic test results from California meadow voles and harvest mice probably represent cross-reaction with SNV antigen by ISLA and EMCV, respectively (13-15). The high prevalence of antibodies identified in meadow voles (22.7% of 29) and harvest mice (14.8% of 108) is a cause for concern, even though human infection by these viruses has not been documented. Precautionary measures should be taken against exposure to hantaviruses through all potential wild rodent reservoirs until more is known about these newly discovered strains. Temporal and Spatial Trends in Deer Mice Populations Our data from historical surveys indicate that SNV was already circulating in deer mice 20 years ago in parts of California. The antibody-positive deer mouse originally trapped in Kern County in 1975 is the oldest documented evidence of SNV infection in wild rodents. Notably, SNV-antibody-positive deer mice identified retrospectively were captured almost 20 years before the first HPS cases were recognized in California and in some of the same geographic regions (20,22,29,31). The slight difference (approximately 2%) between sequences from the Kern County deer mouse trapped in 1976 and a Mono County deer mouse trapped in 1994 indicates a long-standing stability of the virus, as previously demonstrated by Nerukar et al. in Mono County (32). Although SNV infection in deer mice is widespread in California, represented biotypes vary considerably in seroprevalence levels. For example, deer mice in foothill/mountainous (14.5% of 684) counties have a higher seroprevalence than those in inland/valley (0.7% of 151) and coastal (6.4% of 704, excluding the Channel Islands) counties. The trend of increasing prevalence with rising elevation found in this analysis has been observed in other states (Jim Mills, pers. comm.). The Channel Islands offered a unique opportunity to study SNV infection in a relatively isolated population of deer mice. Deer mouse populations have been on the Channel Islands long enough that each island has its own subspecies and have considerable variation genetically within those subspecies (33,34). Likewise, Hjelle et al. found significant divergence between genetic sequences of virus from infected deer mice collected on the islands and those from the nearby coastal mainland (25). Although travel from the mainland to the islands and from island to island is common, evidence suggests that SNV coevolved separately within the deer mouse populations on each island (San Clemente, San Miguel, Santa Catalina, Santa Cruz, Santa Rosa). It appears that the virus is not endemic or is present at very low levels among deer mice on Anacapa, San Nicolas, and Santa Barbara Islands. Human Cases The antibody prevalence of SNV in deer mice collected at potential exposure sites during the investigation of sporadic HPS cases in California (26.8%) was similar to the antibody prevalence (30.0%) in deer mice observed during the 1993 HPS outbreak in the Four Corners region (2). Prevalence was significantly higher (p = 0.002) in deer mice trapped near human case exposure sites than in those from survey sites with no cases (Table 4). Together these findings imply that the percentage of infected deer mice may be a risk factor for human exposure to SNV. In addition, landscape features such as high elevation may be another important predictor of hantavirus in the state. The spatial clustering of HPS cases in the Sierra Nevada range supports this conclusion. Characteristics of the mouse population, the environment, or human lifestyles may explain these geographic differences. The climate and vegetation in the mountains could be conducive to large populations of deer mice, a factor which might influence SNV prevalence. In addition, the occupational and recreational activities of the inhabitants of rural, mountainous environments bring them into frequent contact with rodents. In addition, local residences (e.g., old log cabins) are prone to rodent infestation, a possible risk factor for HPS infection (35). Otteson et al. documented a higher SNV antibody prevalence among rodents trapped near buildings, regardless of the presence of a human case; a case-control study of the Four Corners outbreak had similar findings (30,36). Information on proximity to human dwellings was not available for our analysis; however, most mice were collected near buildings during investigation of human cases. Since other survey sites were probably less likely to be located near human dwellings, this factor may represent a source of bias in our study. Other biases may have been introduced because of nonrandom sampling and small sample size at some survey sites. Systematic longitudinal studies of SNV infection in deer mice at the key locations identified in this analysis are needed to further develop a predictive model for hantavirus infection in California which could elucidate the natural history of SNV and enhance prevention efforts. Public Health Implications Preliminary results indicate a need for health education of residents, visitors, and workers at high risk, especially in the Sierra Nevada range. Human dwellings in the mountains may be more vulnerable to deer mice infestation, especially if the buildings are older and/or intermittently occupied. In addition, persons working in or cleaning these structures may be at an even higher risk (22,29,35,36). Local health care providers and tertiary care centers should be aware of the potential for HPS cases in the state. Acknowledgments The authors thank the many workers who conducted field surveys and participated in the compilation of a state-wide mammal database; those providing laboratory support, including David Cottam, Dale Dondero, CDHS; Mary Lane Martin, George Gallucci, and Brad Hotard, CDC; Jeff Riolo, University of Nevada, Reno; and Vicki Kramer for her helpful comments and review of this manuscript. This work was supported in part by Public Health Service Grant RO1 AI36336. Michele Jay,* Michael S. Ascher,† Bruno B. Chomel,‡ Minoo Madon,§ David Sesline,† Barryett A. Enge,† Brian Hjelle,¶ Thomas G. Ksiazek,¥ Pierre E. Rollin,¥ Philip H. Kass,‡ and Kevin Reilly* *California Department of Health Services, Sacramento, California, USA; †Viral and Rickettsial Diseases Laboratory, Berkeley, California, USA; ‡University of California, Davis, California, USA; §California Department of Health Services, Ontario, California, USA; ¶University of New Mexico, Albuquerque, New Mexico, USA; ¥Centers for Disease Control and Prevention, Atlanta, Georgia, USA References 1. Centers for Disease Control and Prevention. Outbreak of acute illness - southwestern United States, 1993. MMWR Morb Mortal Wkly Rep 1993;42:421-4. 2. Childs JE, Ksiazek TG, Spiropoulou CF, Krebs JW, Morzunov S, Maupin GO, et al. Serologic and genetic identification of Peromyscus maniculatus as the primary rodent reservoir for a new hantavirus in the Southwestern United States. J Infect Dis 1994;169:1271-80. 3. Hjelle B, Jenison S, Torrez-Martinez N, Yamada T, Nolte K, Zumwalt R, et al. A novel hantavirus associated with an outbreak of fatal respiratory disease in the southwestern United States: evolutionary relationships to known hantaviruses. J Virol 1994;68:592-6. 4. Elliott LH, Ksiazek TG, Rollin PE, Spiropoulou CF, Morzunov S, Monroe M, et al. Isolation of the causative agent of hantavirus pulmonary syndrome. Am J Trop Med Hyg 1994;51:102-8. 5. Nichol ST, Spiropoulou CF, Morzunov S, Rollin PE, Ksiazek TG, Feldmann H, et al. Genetic identification of a hantavirus associated with an outbreak of acute respiratory illness. Science 1993;262:914-7. 6. Khan AS, Khabbaz RF, Armstrong LR, Holman RC, Bauer SP, Graber J, et al. Hantavirus pulmonary syndrome: the first 100 cases. J Infect Dis 1996;173:1297-303. 7. Centers for Disease Control and Prevention. Hantavirus pulmonary syndrome - United States, 1995 and 1996. MMWR Morb Mortal Wkly Rep 1996;45:291-5. 8. Morzunov SP, Feldmann H, Spiropoulou CF, Semenova VA, Rollin PE, Ksiazek TG, et al. A newly recognized virus associated with a fatal case of hantavirus pulmonary syndrome in Louisiana. J Virol 1995;69:1980-3. 9. Rollin PE, Ksiazek TG, Elliott LH, Ravkov EV, Martin ML, Morzunov S, et al. Isolation of Black Creek Canal virus, a new hantavirus from Sigmondon hispidus in Florida. J Med Virol 1995;46:35-9. 10. Hjelle B, Lee SW, Song W, Torrez-Martinez N, Song JW, Yanagihara R, et al. Molecular linkage of hantavirus pulmonary syndrome to the white-footed mouse, Peromyscus leucopus: genetic characterization of the M genome of New York virus. J Virol 1995;69:8137-41. 11. Torrez-Martinez N, Hjelle B. Enzootic of Bayou hantavirus in rice rats (Oryzomys palustris) in 1983. Lancet 1995;346:780-1. 12. Song J, Baek LJ, Gajdusek DC, Yanagihara R, Gavrilovskaya I, Luft BJ, et al. Isolation of pathogenic hantavirus from the white footed mouse (Peromyscus leucopus). Lancet 1994;344:1637. 13. Hjelle B, Chavez-Giles F, Torrez-Martinez N, Yates T, Sarisky J, Webb J, et al. Genetic identification of a novel hantavirus of the harvest mouse Reithrodontomys megalotis. J Virol 1994;68:6751-4. 14. Song W, Torrez-Martinez N, Irwin W, Harrison FJ, Davis R, Ascher M, et al. Isla Vista virus: a genetically novel hantavirus of the California vole Microtus californicus. J Gen Virol 1995;76:3195-9. 15. Rowe JE, St. Jeor SC, Riolo J, Otteson EW, Monroe MC, Henderson WW, et al. Coexistence of several novel hantaviruses in rodents indigenous to North America. Virology 1995;213:122-30. 16. LeDuc JW. Epidemiology of Hantaan and related viruses. Lab Anim Sci 1987;37:413-8. 17. Tsai TF. Hemorrhagic fever with renal syndrome: mode of transmission to humans. Lab Anim Sci 1987;37:428-30. 18. Xu ZY, Guo CS, Wu YL, Zhang XW, Liu K. Epidemiological studies of hemorrhagic fever with renal syndrome: analysis of risk factors and mode of transmission. J Infect Dis 1985;152:137-44. 19. Centers for Disease Control and Prevention. Hantavirus infection - southwestern United States: interim recommendations for risk reduction. MMWR Morb Mortal Wkly Rep 1993;42(RR-11):ii-13. 20. Turell MJ, Korch GW, Rossi CA, Sesline D, Enge BA, Dondero DV, et al. Short report: prevalence of hantavirus infection in rodents associated with two fatal human infections in California. Am J Trop Med Hyg 1995;52:180-2. 21. Ornduff R. Introduction to California plant life. Berkeley and Los Angeles: University of California Press, 1974:152. 22. Hjelle B, Torrez-Martinez N, Koster FT, Jay M, Ascher MS, Brown T, et al. Epidemiologic linkage of rodent and human hantavirus genomic sequences in case investigations of hantavirus pulmonary syndrome. J Infect Dis 1996;173:781-6. 23. Yamada T, Hjelle B, Lanzi R, Morris C, Anderson B, Jenison S. Antibody responses to Four Corners hantavirus infections in the deer mouse (Peromyscus maniculatus): identification of an immunodominant region of the viral nucleocapsid protein. J Virol 1995;69:1939-43. 24. Feldmann H, Sanchez A, Morzunov S, Spiropoulou CF, Rollin PE, Ksiazek TG, et al. Utilization of autopsy RNA for the synthesis of the nucleocapsid antigen of a newly recognized virus associated with hantavirus pulmonary syndrome. Virus Res 1993;30:351-67. 25. Hjelle B, Chavez-Giles F, Torrez-Martinez N, Yamada T, Sarisky J, Ascher M, et al. Dominant glycoprotein epitope of four corners hantavirus is conserved across a wide geographical area. J Gen Virol 1994;75:2881-8. 26. Dean JA, Coulombier D, Smith DC, Brendel KA, Arner TG, Dean AG. Epi Info, version 6: a word processing, database, and statistics program for public health on IBM-compatible microcomputers. Atlanta: Centers for Disease Control and Prevention, 1994:601. 27. EGRET. Seattle: Statistics and Epidemiological Research Corporation, 1995. 28. Douglass RJ, Van Horn R, Coffin KW, Zanto SN. Hantavirus in Montana deer mouse populations: preliminary results. J Wildl Dis 1996;32:527-30. 29. Jay M, Hjelle B, Davis R, Ascher M, Baylies HN, Reilly K, et al. Occupational exposure leading to hantavirus pulmonary syndrome in a utility company employee. Clin Infect Dis 1996;22:841-4. 30. Otteson EW, Riolo J, Rowe JE, Nichol ST, Ksiazek TG, Rollin PE, et al. Occurrence of hantavirus within the rodent population of northeastern California and Nevada. Am J Trop Med Hyg 1996;54:127-33. 31. Shefer AM, Tappero JW, Bresee JS, Peters CJ, Ascher MS, Zaki SR, et al. Hantavirus pulmonary syndrome in California: report of two cases and investigation. Clin Infect Dis 1994;19:1105-9. 32. Nerukar VR, Song JW, Song KJ, Nagle JW, Hjelle B, Jenison S, et al. Genetic evidence for a hantavirus enzootic in deer mice (Peromyscus maniculatus) captured a decade before the recognition of hantavirus pulmonary syndrome. Virology 1994;204:563-8. 33. von Bloeker JC. Land mammals of the southern California islands. Santa Barbara (CA): Santa Barbara Botanic Garden, 1967:106. 34. Gill AE. Evolutionary genetics of California Islands Peromyscus. In: Power DM, editor. The California Islands. Santa Barbara (CA): Santa Barbara Museum of Natural History, 1980:719-43. 35. Armstrong LR, Zaki SR, Goldoft MJ, Todd RL, Khan AS, Khabbaz RF, et al. Hantavirus pulmonary syndrome associated with entering or cleaning rarely used, rodent-infested structures. J Infect Dis 1995;172:1166. 36. Childs JE, Krebs JW, Ksiazek TG, Maupin GO, Gage KL, Rollin PE, et al. A household-based, case-control study of environmental factors associated with hantavirus pulmonary syndrome in the southwestern United States. Am J Trop Med Hyg 1995;52:393-7. --------------------------------------------------------------------------- [Emerging Infectious Diseases * Volume 3 * Number 2 * April-June 1997] Dispatches Gestational Psittacosis in a Montana Sheep Rancher --------------------------------------------------------------------------- In humans, psittacosis is primarily a flulike illness following exposure to psittacine birds. In rare cases, pregnant women exposed to Chlamydia psittaci can contract gestational psittacosis: atypical pneumonia, sepsis, and placental insufficiency resulting in premature birth or miscarriage. In the United States, only two cases of gestational psittacosis have been reported, both from exposure to psittacine birds. Eleven other cases have been reported worldwide, mostly in the United Kingdom, all from exposure to infected birth fluids and membranes of farm mammals, notably sheep and goats. In these mammals, C. psittaci inhabit the reproductive tract, are transmitted sexually or by the fecal-oral route, and cause miscarriages. The case of gestational psittacosis in a Montana sheep rancher is the first farm animal-related case reported in the United States. Pregnant women should avoid close contact with C. psittaci-infected animals, particularly sheep and goats during the birthing season. Obstetricians should consider this diagnosis along with early antibiotic treatment and cesarean section delivery in the context of the patient's case history. Psittacosis is a flulike systemic infection, often with fever, headache, and atypical pneumonia, caused by Chlamydia psittaci. The number of reported cases varies from year to year because of periodic outbreaks, although the true baseline incidence in the United States is thought to be 75 to 100 cases per year with 1 or 2 deaths (1). Montana typically reports one case per year (Montana Dept. of Health surveillance data). Many cases are probably not diagnosed. In most reported cases, transmission occurs by inhaling infectious material from diseased psittacine birds (2). However, not all cases of psittacosis result from inhaling avian strains of C. psittaci, nor are they all manifested as a simple flulike illness or atypical pneumonia. In rare cases, pregnant women contract severe chlamydial disease after exposure to the infected birth fluids and membranes of goats and sheep (3). This "gestational psittacosis" can be defined as a flulike syndrome leading to sepsis, placental infection, and fetal compromise (4). Only 13 cases have been reported worldwide: Eleven after exposure to gravid sheep and goats (United Kingdom and France) and two after exposure to psittacine birds (United States). This is the first farm animal-related case reported in the United States. Case Report In April 1996, a previously healthy 25-year-old Montana sheep rancher, pregnant for the first time, had cough and congestion for 14 days at weeks 19 to 21 of gestation; the symptoms were followed by 4 days of high fever (104°F), myalgia, headache, fatigue, and backache, and 2 days of abdominal pain. Upon hospitalization, a chest X-ray was normal, but laboratory tests showed anemia (Hg 10.7 g/dl), thrombocytopenia (platelets 42,000/ml), and hepatic dysfunction (SGOT 351 I/L), as well as proteinuria (2+) and hematuria (1+). Other tests showed a positive lupus anticoagulant and positive anticardiolipin antibodies. Blood, urine, and sputum cultures (collected before antibiotics were administered) yielded negative results. Admitting diagnosis was "early severe and low platelet count) syndrome" with a possible concurrent viral infection and poor hydration accounting for the fever and lack of hypertension. On the second day of hospitalization, the patient underwent emergency termination of the pregnancy (22-23 weeks gestation). On the following day, the patient still had high fevers; moderate respiratory distress with tachypnea developed, and oxygen was required. A chest X-ray showed diffuse bilateral alveolar infiltrates; antibiotic treatment (IV Ancef) was started for presumed pneumonia. The fever subsided, the patient's condition improved remarkably, and she was discharged within 3 days. The discharge diagnosis was early severe HELLP syndrome (probably related to lupus anticoagulant and anticardiolipin antibodies) with coincident pneumonia. On followup, the patient was feeling well and had resumed her activities around the ranch. Suspicious of a diagnosis related to environmental exposure and motivated by a need to explain all of the patient's symptoms, the obstetrician sent placental and fetal tissue to California and Oklahoma for specialized pathologic examination, after which patient sera were sent to the Centers for Disease Control and Prevention (CDC) in Atlanta, Georgia, and animal sera were sent to the Veterinary Diagnostic Laboratory in Bozeman, Montana. A concomitant epidemiologic investigation was initiated. Hematoxylin and eosin stain of the placenta showed placentitis: an intense acute inflammation of the intervillous space, more on the maternal side, which suggested infection from hematogenous spread rather than from ascension from the birth canal. Numerous basophilic intracytoplasmic inclusions in the cytoplasm of the trophoblast appeared to contain minute cocci-shaped organisms. The inclusions were identified by genus-specific fluorescein-tagged monoclonal antibody staining as masses of Chlamydia (either pneumoniae or psittaci) in various stages of development. Electron micrographs further defined the round, rather than pear-shaped, morphologic features of the elementary bodies, which suggested psittaci rather than pneumoniae as the specific species. The pathologic findings are reviewed in greater detail, including photographs, in a concurrent publication (4). Because traditional complement-fixation serologic tests do not adequately differentiate the chlamydial species in humans, sera were sent to CDC for a microimmunofluorescence assay, which is more sensitive and specific (5). The patient's sera had very high (1:512) IgG antibody titer to C. psittaci; identical titer was seen on sera collected several months later. No IgM to C.psittaci was detected. Tests for the other chlamydia, as well as for other placental-acquired infections (e.g., Q fever and brucellosis) were negative. The epidemiologic investigation showed that, during the week before hospitalization, the patient's husband had a similar flulike illness with mild respiratory symptoms. The spring lambing season began 4 to 6 weeks before hospitalization, during which the patient and her husband worked closely with gravid sheep. Out of a flock of 24 sheep, 19 gave birth to 30 lambs. There were six lamb deaths but no reported abortions. The patient assisted in most deliveries; however, she had direct contact on just three occasions: pulling one lamb during a twin birth, pulling one kid during the twin birth of her pet goat, and assisting in the premature delivery of a yearling ewe. The latter resulted in considerable placental exposure. She spent approximately 1 hour manually extracting the retained placenta, wearing only plastic gloves; she did not cover the mouth or nose. Serologic testing of five sheep and two goats was performed by complement fixation for C. psittaci. Only sera from two sheep were positive, including the yearling ewe from which the patient manually extracted the retained placenta. The sheep were purchased from a neighboring flock with reported "pink eye" and abortions, both of presumed chlamydial etiology. The flock's abortion problem resolved after tetracycline-fortified feed was administered just before yearly breeding. Neither antibiotic feed nor the available chlamydia vaccine was used for the sheep on the patient's ranch. During her pregnancy, the patient had minimal contact with other ranch animals, including cattle, horses, and poultry; none of these animals were ill or had abortions. She had no contact with psittacine birds. HELLP is a variant of the preeclampsia-eclampsia syndrome, which also includes epigastric pain and liver tenderness, as well as hypertension, edema, and proteinuria. An underappreciated early symptom is generalized malaise and/or flulike illness (6,7). Antiphospholipid antibodies, such as the lupus anticoagulant and anticardiolipin antibodies, have been associated with thrombosis, thrombocytopenia, and pregnancy complications, particularly decidual vasculopathy, placental infarction, fetal growth retardation, early-onset preeclampsia, recurrent miscarriages, and fetal death (8). Initially, in this patient, except for the high fever and lack of hypertension, the symptoms reasonably conformed to those of HELLP syndrome. However, in this case, epidemiologic, clinical, laboratory (human and animal), and histopathologic data support the diagnosis of gestational psittacosis. The most likely mechanism of transmission was inhalation of C.psittaci while manually extracting the retained placenta from the C. psittaci-infected sheep that lambed prematurely just 2 weeks before the patient's hospitalization. The usual incubation time for psittacosis is 1 to 4 weeks (2). In the United States, pneumonia acquired through contact with birth membranes or fluids of farm animals is more commonly caused by Coxiella burnetti (Q-fever) or Brucella sp. (brucellosis) (9). In both diseases, the flulike syndrome does not lead to fetal compromise in pregnant women. However, in gestational psittacosis, the flulike illness results in sepsis, placental infection, and fetal compromise. The disease is relatively new, first reported in the United Kingdom in 1967, and rare, just 13 cases reported worldwide (4,10,11). Gestational psittacosis has occurred from exposure to psittacine birds (the United States: two previous cases; 12,13) and from exposure to infected birth fluids and membranes of sheep or goats (the United Kingdom: nine cases, all sheep [10,11,14-19]; France: two cases, both goats [20,21]). This is, therefore, the third case reported in the United States, the first related to farm animals (4). Further review of the clinical details of the 13 other reported cases shows remarkable similarity between them and the case reported here. For example, in all 14 reported cases (including this case) the illness is manifested as a flulike febrile syndrome. Similarly, in the 14 cases, thrombocytopenia and/or coagulopathy were reported (12 [85%]), as well as pulmonary disease (12 [85%]) and liver disease (11 [78%]). The outcome of pregnancy is also similar: 11 (78.5%) of 14 pregnancies ended in fetal death, while the three surviving neonates were born by cesarean section before 34 weeks gestation (4). Maternal outcome was much better: 13 of the 14 women recovered fully after pregnancy termination. The other woman died of overwhelming sepsis. Erythromycin was administered to six of the 14 pregnant women, including the mothers of the three surviving infants, early in the illness (4,10,12,13). Tetracycline, the drug of choice for psittacosis, is usually contraindicated during pregnancy, although it is still recommended for cases of gestational psittacosis that appear refractory to erythromycin (12,13). C. psittaci is known worldwide as the primary cause of abortion in sheep, often referred to as "enzootic abortion of ewes", "chlamydial abortion," or simply "enzootic abortion." Enzootic abortion in sheep was first reported in Scotland in 1936, where C. psittaci became known as the "ewe abortion agent" (10,22). Abortion usually occurs within 2 years of contact with other aborting sheep in the flock. Indeed, pregnant sheep experimentally infected with an ovine abortion isolate of C.psittaci either abort or give birth to weak lambs and maintain a persistent systemic antibody response to the organism for up to 2.5 years postinfection; for sheep that aborted, detectable amounts of chlamydial antigen are excreted from the reproductive tract during subsequent estrus cycles (23). Postpartum (or postabortive) infected sheep are considered protected from subsequent C. psittaci-induced pregnancy complications, and they remain healthy, fertile, and therefore able to transmit the organism within the flock, perhaps through sexual contact (23,24). Moreover, C. psittaci organisms are found in eye, respiratory, oral, and fecal material, which suggests other modes of transmission. Indeed, environmental contamination from diseased placentae or vaginal discharge is considered the primary source of infection to other sheep, perhaps through ingestion of infected tissue or contaminated feed during the previous or current lambing season and subsequent intestinal colonization (23,24). The carrier state is not evident but is often presumed if a high incidence of abortions or premature lambing occurs in the flock. Sometimes a high rate of "pink eye" in the flock indicates high C. psittaci prevalence, although this is usually caused by a serovar different from the one causing abortion. Nevertheless, ranchers who suspect C. psittaci in the flock typically respond by physically isolating infected sheep, giving antibiotic feed, and/or using the chlamydial vaccine. However, these methods rarely eliminate the disease from the flock (23). In Montana, 50 to 100 aborted sheep fetuses are examined each year, more than 50% of which test positive for C. psittaci by complement fixation on sera or enzyme-linked immunosorbent assay on placental tissue. For this reason, masks are always worn by laboratory workers during sheep (and psittacine bird) autopsies (L. Stackhouse, Montana Veterinary Diagnostic Laboratory, pers. comm.). It is difficult to estimate the overall rate of colonization/infection within sheep flocks, although it is presumed to be high, particularly in the United Kingdom, and in areas of the United States where sheep abortions have already occurred and feed-antibiotics or chlamydial vaccine is not routinely used. High rates of sheep infection, thus far, have not led to high rates of miscarriage in female sheep ranchers. Nevertheless, given the increasing number of small family farms or hobby farms in the western United States, a growing number of farmers could be raising sheep (and other animals) without knowing the potential hazards to human health and how to prevent them. Thus, it is strongly recommended that pregnant women avoid contact with membranes or birth fluids of sheep and goats and close contact with psittacine birds during pregnancy. Moreover, obstetricians should consider the diagnosis of gestational psittacosis in pregnant patients initially presumed to have HELLP syndrome and/or a flulike illness, particularly during the spring lambing season, so that appropriate early antibiotics and cesarean section delivery can help reduce illness and death from the disease. Acknowledgments The author would like to thank Drs. Mark Miles (Great Falls, MT), Mary Ballinger (Belt, MT), Larry Stackhouse (Bozeman, MT), Kurt Benirschke (San Diego, CA), Scott Hyde (Tulsa, OK), and K.H. Wong (Atlanta, GA) for their technical contributions to this investigation and their encouragement and expert advice. Daniel M. Jorgensen Montana State Medical Officer References 1. Centers for Disease Control and Prevention. Summary of Notifiable Diseases, 1995. MMWR Morb Mortal Rep 1995;44(53 suppl):50-74. 2. Benenson A, editor. Control of communicable diseases manual, 16th edition. American Public Health Association, 1995;377-9. 3. Sclossberg D. Chlamydia psittaci. In: Mandel G, editor. Principles and practice of infectious diseases, 4th edition, 1995. New York: Churchill Livingstone, Inc.;1694-5. 4. Hyde SR. Gestational psittacosis: report of a case with literature review. Mod Path. In press. 5. Wong KH, Skelton SK, Daugherty H. Utility of complement fixation and microimmunofluourescence assays for detecting serologic responses in patients with clinically diagnosed psittacosis. J Clin Microbiol 1994;32:2417-21. 6. Cunningham F, MacDonald P, Gant N, Levene K, Gilstrap L, editors. Hypertensive disorders in pregnancy. In: Williams Textbook of Obstetrics. Norwalk (CT): Appleton and Lange, 1994; 763-90. 7. Tomsen TR. HELLP syndrome (hemolysis, elevated liver enzymes, and low platelets) presenting as generalized malaise. Am J Obstet Gynecol 1995;172:1876-80. 8. Cunningham F, MacDonald P, Gant N, Levene K, Gilstrap L, editors. Connective tissue disorders. In: Williams Textbook of Obstetrics. Norwalk (CT): Appleton and Lange, 1994; 1229-37. 9. Donowitz G, Mandell G. In: Mandel G, editor. Acute Pneumonia. In: Principles and practice of infectious diseases. 4th edition.New York: Churchill Livingstone, Inc., 1995;619-34. 10. Beer RJS, Bradford WP, Hart RJC. Pregnancy complicated by psittacosis acquired from sheep. BMJ 1982;284:1156-7. 11. Roberts W, Grist NR, Giroud P. Human abortion associated with infection by ovine abortion agent. BMJ 1967;4:37. 12. Gherman RB, Leventis LL, Miller RC. Chlamydial psittacosis during pregnancy: a case report. Obstet Gynecol 1985;86:648-50. 13. Khatib R, Huthayipailayam C, Thirumoorthi M, Kelly B, Grady K. Severe psittacosis during pregnancy and suppression of antibody response with early therapy. Scand J Infect Dis 1995;27:519-21. 14. Johnson FW, Matheson BA, Williams H, Laing AG, Jandial V, Davidson-Lamb R, et al. Abortion due to infection with Chlamydia psittaci in a sheep farmer's wife. BMJ 1985;290:592-4. 15. Wong SY, Gray ES, Buxton D, Finlayson J, Johnson FW. Acute placentitis and spontaneous abortion caused by Chlamydia psittaci of sheep origin: a histological and ultrastructural study. J Clin Pathol 1985;38:707-11. 16. Helm CW, Smart GE, Cumming AD, Lambie AT, Gray JA, MacAulay A, Smith IW.. Sheepacquired severe Chlamydia psittaci infection in pregnancy. Int J Gynaecol Obstet 1989;28:369-72. 17. McGivern D, White R, Paul ID, Caul EO, Roome AP, Westmoreland D. Concomitant zoonotic infections with ovine Chlamydia and Q fever in pregnancy: clinical features, diagnosis, management, and public health implications. Case report. Br J Obstet Gynaecol 1988;95:294-8. 18. Crosse BA, Gomes P, Muers MM. Ovine psittacosis and sarcoidosis in a pregnant woman. N Engl J Med 1971;284:642-53. 19. Hadley KM, Carrington D, Frew CE, Gibson AA, Hislop WS. Ovine chlamydiosis in an abattoir worker. J Infect 1992;25:105-9. 20. Villemonteix P, Agius G, Ducroz B, Rouffineau J, Plocost V, Castets M, Magnin G. Pregnancy complicated by severe Chlamydia psittaci infection acquired from a goat flock: a case report. Eur J Obstet Gynecol Repr Biol 1990;37:91-4. 21. Berthier M, Bonneau D, Marechaud M, Oriot D, Deshayes M, Leillain P, Magnin G. Maternal-fetal infection by Chlamydia psittaci transmission from a goat: a new zoonosis? Bull Soc Path Exot 1991;84:590-6. 22. Hart CA, Broadhead RL. Neonatal infections. In: A Colour Atlas of Paediatric Infectious Diseases. Aylesbury, England: Wolfe Publishing, 1992;18-9. 23. Papp JR, Shewen PE, Gartley CJ. Abortion and subsequent excretion of chlamydiae from the reproductive tract of sheep during estrus. Infect Immun 1994;62:3786-92. 24. Papp JR, Shewen PE. Localization of chronic Chlamydia psittaci infection in the reproductive tract of sheep. J Infect Dis 1996;174:1296-301. --------------------------------------------------------------------------- [Emerging Infectious Diseases * Volume 3 * Number 2 * April-June 1997] Dispatches Lack of Serologic Evidence for an Association between Cache Valley Virus Infection and Anencephaly and other Neural Tube Defects in Texas --------------------------------------------------------------------------- We tested the hypothesis that Cache Valley Virus (CVV), an endemic North American bunyavirus, may be involved in the pathogenesis of human neural tube defects. This investigation followed a 1990 and 1991 south Texas outbreak of neural tube defects with a high prevalence of anencephaly and the demonstration in 1987 that in utero infection by CVV was the cause of outbreaks of central nervous system and musculoskeletal defects in North American ruminants. Sera from 74 women who gave birth to infants with neural tube defects in south Texas from 1993 through early 1995 were tested for CVV neutralizing antibody. All tested sera did not neutralize CVV. These data suggest that CVV is not involved in the induction of human neural tube defects during nonepidemic periods but do not preclude CVV involvement during epidemics. Other endemic bunyaviruses may still be involved in the pathogenesis of neural tube defects or other congenital central nervous system or musculoskeletal malformations. Anencephaly, spina bifida, and encephalocele (the major types of neural tube defects) are generally due to the failure of the neural tube to close during early embryonic development (1). Neural tube defects are among the most common and most severe major birth defects. Anencephaly is caused by failure of the anterior neuropore to close during embryonic development and results in total or partial absence of the cranial vault, the covering skin, and the brain. Infants with anencephaly are stillborn or die shortly after birth. Spina bifida is caused by a disturbance in the normal closure of neural walls and results in spinal cord defects. Most infants with spina bifida survive surgical repair of the defect with residual neurologic handicaps of varying severity. Encephaloceles are skull defects through which skin-covered meninges, with or without brain tissue, herniate. Small to moderately sized encephaloceles are surgically correctable (1-4). The prevalence of neural tube defects in the United States has been steadily declining (5) and is currently estimated to be six per 10,000 births. The prevalence of anencephaly in the United States has likewise declined and is now approximately three per 10,000 live births (4). A vital record study of anencephaly in Texas showed that from 1981 to 1986 the prevalence rate was 3.8 to 4.3 cases per 10,000 births (6). This study also showed that in south Texas during this period the average annual prevalence of anencephaly was approximately 4.9 per 10,000 births. Women with Hispanic surnames, three or more previous live births, history of stillbirth, or residence in east or south Texas were at increased risk for neural tube defect-affected pregnancies. On the basis of vital record data, the annual prevalence of anencephaly in south Texas from 1981 through 1986 was approximately 4.9 per 10,000 live births. In 1991 three babies with anencephaly were born over a 36-hour period at a single hospital in Cameron County, the southernmost county in Texas (Brownsville is the county's largest city). The ensuing study, which used active multisource case finding rather than vital records, showed that the neural tube defect prevalence rate increased from 14.7 per 10,000 births in 1986 to 1989 to 27.1 per 10,000 births in 1990 to 1991. The higher rate was due largely to an increase in anencephaly cases. From 1986-89 to 1990-91, the average annual anencephaly prevalence rate rose from 9.6 to 19.7 per 10,000 births (7,8). Despite the high prevalence of neural tube defects and the significant rate of illness associated with them, much remains to be learned about their complex multifactorial etiology. Evidence suggests that these defects are etiologically heterogeneous and may follow fetal insults such as maternal diabetes, hyperthermia, folic acid deficiency, and anticonvulsant (valproate) therapy (9-13). In 1987, before the increase in prevalence of human anencephaly in south Texas, an outbreak of severe congenital malformations of the central nervous system and musculoskeletal system of lambs occurred in San Angelo, Texas (14). At the time of the outbreak, there was no active surveillance of human birth defects in San Angelo, and no reports were received of human birth defects in the area. The ovine problem was later found to be caused by in utero infection by Cache Valley Virus (CVV). Although this insect-borne bunyavirus had been known to commonly infect North American ruminants (15), it was not thought to be of clinical significance. Experimentally, it was determined that CVV infection of the dam in early gestation and transplacental infection of the ovine fetus could produce severe brain malformations and arthrogryposis multiplex congenita, an anomaly characterized by limbs fixed in contracture (14). Central nervous system malformations associated with experimental and spontaneous CVV infection include hydrocephalus, hydranencephaly, porencephaly, micrencephaly, and micromelia. After the syndrome was characterized, outbreaks of CVV-induced malformations in ruminants were diagnosed throughout North America, and work by Calisher and Sever (16) also linked CVV to congenital cases of human macrocephaly in the United States. Other bunyaviruses can cause identical congenital malformations of the central nervous system in experimentally infected livestock (14). Human congenital morbidity has also been correlated with maternal antibody to bunyaviruses (16). A recent study correlated both human microcephaly and macrocephaly with antibody to Tenshaw virus in mothers of infants with these illnesses. We decided to test the hypothesis that CVV infection was related to human neural tube defects. Public concern regarding the 1990 to 1991 cluster in Brownsville, Texas, (7) had resulted in an ongoing project in the 14 Texas counties that border Mexico. A neural tube defect surveillance and folic acid intervention project were implemented in 1993, and a case-control study was begun in mid-1995. Sera from case patients had been banked before the case-control study began. Sera from 74 women who lived in the Texas border counties and had neural tube defect-affected pregnancies (36 with spina bifida, 34 with anencephaly, and 4 with encephalocele) from 1993 through early 1995 were examined for a possible link between CVV and neural tube defects. With a standard microtiter serum dilution neutralization test (17), the sera were screened at final dilutions of 1:2, 1:4, 1:8, and 1:16. The virus used in all tests was the prototype CVV (strain 6V-633, provided by the Centers for Disease Control and Prevention [CDC], Ft. Collins, Colorado), which had been passaged one time in Vero cells after receipt from CDC. Controls included sera from women of undetermined CVV status who gave birth to healthy infants in south Texas [8]; sera collected from sheep before CVV infection [3]; and normal macaque [4], horse [1], and bovine [1] sera. Positive controls included CVV-convalescent-phase ovine sera [3] and CVV antibody-positive sera from a horse and a cow. No serum neutralization activity for CVV was detected in sera from women who gave birth to healthy infants or infants with neural tube defects. Had CVV infection been present in these women during gestation, CVV antibody would have been detectable postpartum. Before this study, the relationship between CVV and human neural tube defects was unknown. Testing an adequate number of controls is critical when seroepidemiology is used to establish a causal relationship between an agent and a low frequency event or malformation, particularly when case patients have evidence of antibodies against the agent of interest. In this study, there was no evidence that CVV was related to the neural tube defect cases observed in Texas from 1993 through early 1995. Had CVV antibodies been detected in serum from women with neural tube defect-affected pregnancies, it would have been necessary to test control sera from age- and location-matched women with normal births. The average annual neural tube defect prevalence rate in Cameron County, Texas, for 1992 to 1995 has returned to the 1986 to 1989 rate of approximately 14-15 cases per 10,000 births. These data suggest that CVV is not involved in the induction of human neural tube defects during nonepidemic periods but do not preclude CVV involvement during epidemics. CVV may still be involved in induction of other human malformations. Other endemic bunyaviruses may be involved in the pathogenesis of neural tube defects and of other congenital nervous system or musculoskeletal malformations (18,19). It would seem valid to continue to investigate the relationship of CVV and other arboviruses to human developmental illness and death rate. Because of the wide variety of defects caused by these viruses, laboratory models of fetal infection by the Bunyaviridae would facilitate the understanding of viral teratogenesis mechanisms in humans. J. F. Edwards* and K. Hendricks† *Texas A&M University, College Station, Texas, USA; and †Texas Department of Health, Austin, Texas, USA References 1. Copp AJ, Brooks SA, Estibeiro JP, Shum AS, Cockcroft DL. The embryonic development of mammalian neural tube defects. Prog Neurobiol 1990;35:363-403. 2. World Health Organization. Congenital malformations worldwide: a report from the international clearinghouse for birth defects monitoring systems 1991. New York: Elseviers Science Publishers, 1991:41-79. 3. Campbell LR, Dayton DH, Sohal GS. Neural tube defects: a review of human and animal studies on the etiology of neural tube defects. Teratology 1986;34:171-87. 4. Thomas JA, Markovac J, Ganong WF. Anencephaly and other neural tube defects. Front Neuroendocrinol 1994;15:197-201. 5. Yen IH, Khoury MJ, Erickson JD, James LM, Waters GD, Berry RJ. The changing epidemiology of neural tube defects: United States. Am J Dis Child 1992;146:857-61. 6. Brender JD, Carmichael L, Preece MJ, Larimer GC, Suarez L. Epidemiology of anencephaly in Texas, 1981-1986. Tex Med 1989;85:33-5. 7. Albrecht LJ. Mystery in Cameron County. Physicians and health officials search for cause of high rate of anencephaly in the Rio Grande Valley. Tex Med 1994;90:16-18. 8. Texas Department of Health/Centers for Disease Control. An investigation of a cluster of neural tube defects in Cameron County, Texas. July 1, 1992. 9. Ardinger HH, Atkins JF, Blackston RD, Elsas LJ, Clarren SK, Livingstone S, et al. Verification of the fetal valproate phenotype. Am J Med Genet 1988;29:171-85. 10. Finnell RH, Taylor LW, Bennett GD. The impact of maternal hyperthermia on morphogenesis: clinical and experimental evidence for a fetal hyperthermia phenotype. Developmental Brain Dysfunction 1993;6:199-209. 11. Mills JL, Baker L, Goldman S. Malformations in infants of diabetic mothers occurs before the seventh gestational week. Diabetes 1979;28:292-3. 12. Sandford MK, Kissling GE, Joubert PE. Neural tube defect etiology: new evidence concerning maternal hyperthermia, health and diet. Dev Med Child Neurol 1992;34:661-75. 13. Willett WC. Folic acid and neural tube defects: can't we come to closure. Am J Pub Health 1992;82:666-8. 14. Edwards JF. Cache Valley virus. Vet Clin North Am: Food Anim Pract 1994;10:515-24. 15. Calisher CH, Francy DB, Smith GC, Muth DJ, Lazuick JS, Karabatsos N, et al. Distribution of Bunyamwera serogroup viruses in North America, 1956-1984. Am J Trop Med Hyg 1986;35:429-43. 16. Calisher CH, Sever JL. Are North American Bunyamwera serogroup viruses etiologic agents of human congenital defects of the central nervous system? Emerg Inf Dis 1995;1:147-51. 17. Pantuwatana S, Thompson WH, Watts DM, Hanson RP. Experimental infection of chipmunks and squirrels with LaCrosse and trivittatus viruses and biological transmission of LaCrosse virus by Aedes triseriatus. Am J Trop Med Hyg 1972;21:476-81. 18. Hall JG. Genetic aspects of arthrogryposis. Clin Orthop 1985;184:44-53. 19. Davies-Wynne R, Lloyd-Roberts GC. Arthrogryposis multiplex congenita; search for prenatal factors in 66 sporadic cases. Arch Dis Child 1976;51:618-23. --------------------------------------------------------------------------- [Emerging Infectious Diseases * Volume 3 * Number 2 * April-June 1997] Dispatches Rabies Postexposure Prophylaxis Survey—Kentucky, 1994 --------------------------------------------------------------------------- A survey of rabies postexposure prophylaxis administered by local health departments for a 1-year period showed that very few patients received treatment as a result of exposure to a confirmed rabid animal. Most prophylaxis was administered for contact with domestic animals in situations where existing recommendations for quarantine or laboratory testing of the animal were not followed. Because rabies in domestic animals in Kentucky is uncommon, these findings suggest that had the existing recommendations been followed, the prophylaxis would have been unnecessary in most cases. Rabies postexposure prophylaxis (PEP) is expensive, not totally free of risk, and overused (1). A national public health objective for the year 2000 is to reduce the number of prophylaxis treatments by 50% (2). In Kentucky, where PEP is administered in public and private settings, there are no baseline data on PEP use. A survey of local health departments was used to determine the nature of each patient's exposure to rabies. The number of PEP treatments administered by all providers in Kentucky was estimated from local health department information on rabies biologics purchases and use. Survey and Sales Summary In May 1995, the 1994 invoices of the Kentucky Department for Health Services, Vaccine Depot, were reviewed to determine which local health departments received 1.0 ml doses of human diploid cell vaccine for PEP. (Local health departments used 1.0 ml human diploid cell vaccine for PEP only, and 0.1 ml human diploid cell vaccine intradermally for all rabies preexposure prophylaxis). Data from two large health departments that acquired their vaccine directly from the manufacturer rather than from the Vaccine Depot were included in the survey. In June 1995, local health departments that had administered at least one PEP during 1994 were asked to review the records of patients receiving PEP. Information (patient's age and sex, the number of doses of human diploid cell vaccine, whether human rabies immune globulin was administered, exposure information, and method of payment for the treatment) collected on each patient was recorded on a standardized form by the same telephone surveyor during a followup telephone call. All data were entered into an Epi Info Version 5.0 record file and analyzed in either the Analysis or Statcalc Programs for summary statistics and/or odds ratios, confidence intervals, Fisher's exact test, or Chi-square at the .05 significance level (3). A sales record summary for human diploid cell vaccine sold to all providers in Kentucky was obtained from the only manufacturer of human rabies vaccine recording any sales in Kentucky that year (Connaught Laboratories, Inc., Swiftwater, PA). The number of PEPs administered in the state by all providers was estimated by comparing local health department purchases and use with the total number of human diploid cell vaccine 1.0 ml doses sold to other providers with Kentucky addresses. PEP Administration Profile Vaccine Depot records indicated that 28 health departments treated a total of 97 patients. The number of PEP regimens administered per health department ranged from 1 to 23 with a median of 1 PEP for the year. Fifty-two (53.6%) of the patients were male (Table 1); the median age was 28 years (range 2 to 71); 34 (35.1%) patients were younger than 18 years of age; 59 (60.8%) were older than 18 years of age; and for 4 (4.1%), age was unknown. No significant differences were observed in the type of animal exposure by sex or age. Seven patients (7.2%) had previously received PEP and were treated with two to three doses of human diploid cell vaccine and no human rabies immune globulin. Table 1. Characteristics of local health department patients receiving rabies postexposure prophylaxis -------------------------------------------------- Sex Male 52 Female 43 Unspecified 2 Age(a) Youth (2 - 10) 19 Adolescent (11 - 17) 15 Adult (18-71) 59 Unspecified 4 Health department location(b) Urban 48 Rural 49 Previously immunized 6 Animal exposure Wild 15 Domestic (50 dogs, 29 cats, 1 80 horse) Unspecified 2 Type of exposure Bite or contact 72 with saliva No contact with saliva 17 Unspecified 8 Treatment payer Private insurance 39 Medicaid 7 Medicare 3 Patient 14 Other (employer, worker's 3 compensation) Unspecified 6 No reimbursement 25 -------------------------------------------------- (N=97) (a) [mean] = 28 yrs. (b) Health departments in urban areas, as defined by the 1990 census of population for Kentucky. Metropolitan statistical areas were more likely to administer PEP than rural departments. (p=.033) Urban health departments (in the three metropolitan statistical areas of the state) were more likely to administer PEP than rural health departments (odds ratio = 1.54, confidence interval = 1.01, 2.33) (4). Patients did not significantly differ in age, sex, or type of exposure between urban and rural health departments. For 25 (25.8%) of the patients, local health department funds covered the expense of PEP treatments; no payment was received from private insurance, Medicaid, Medicare, or the patient. There were no significant differences in payment characteristics between urban and rural health department patients. Bite exposures were responsible for 71 (73.2%) of the 97 PEP treatments, 18 (18.6%) exposures were scratches, licks, or "other," and 8 (8.2%) exposure types were not recorded. Domestic animals accounted for 80 (82.5%) of the exposures treated. Type of Animal Exposure Sixty-four (77.1%) of 83 animals involved in these incidents were not available for observation or testing. For wild animals, testing was performed in 3 (20%) of 15 incidents. Testing or observation occurred in only 16 (20.0%) of 80 domestic animal exposures. Stray domestic animals accounted for 26 (26.8%) of all exposures. Another 19 (19.6%) of the incidents involved owned dogs that were unavailable for testing or observation. Unavailability for testing was due to severe brain damage caused by clubbing or gunshot by irate owners, death and disposal of the animal without testing, or the animal's escape. For 36 (37%) incidents, the reason for not testing or observing the animal was not specified. Thirteen (13.4%) of the patients were exposed to an animal that was tested and found to be positive for rabies, and two of these patients had bite exposures. The remaining exposures to these rabies-positive animals were either low-risk exposures or not true exposures (Table 2). Table 2. Patients receiving postexposure prophylaxis for exposure to a confirmed rabid animal in Kentucky, 1994 --------------------------------------------------------------------------- Species Type of exposure Previous history of prophylaxis --------------------------------------------------------------------------- Bat Bite No Cat(a) Mucus & Saliva Yes(b) Cat(a) Mucus & Saliva No Cat(a) Cleaned exam table No Cat(a) Cleaned exam instruments No Dog(c) Bite Yes Dog(c) Touch Yes Dog(c) Tou